Incidental Mutation 'R5719:Fam234a'
ID501388
Institutional Source Beutler Lab
Gene Symbol Fam234a
Ensembl Gene ENSMUSG00000024187
Gene Namefamily with sequence similarity 234, member A
SynonymsItfg3
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26211822-26244223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26214653 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 399 (Q399L)
Ref Sequence ENSEMBL: ENSMUSP00000113418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000118487] [ENSMUST00000122058] [ENSMUST00000151293]
Predicted Effect probably benign
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114988
AA Change: Q399L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187
AA Change: Q399L

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118487
AA Change: Q399L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113418
Gene: ENSMUSG00000024187
AA Change: Q399L

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect unknown
Transcript: ENSMUST00000141240
AA Change: Q87L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect probably benign
Transcript: ENSMUST00000151293
SMART Domains Protein: ENSMUSP00000117020
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Meta Mutation Damage Score 0.2883 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Fam234a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Fam234a APN 17 26213526 missense probably damaging 1.00
IGL02635:Fam234a APN 17 26214453 missense possibly damaging 0.63
R0269:Fam234a UTSW 17 26216617 missense probably benign
R0617:Fam234a UTSW 17 26216617 missense probably benign
R1687:Fam234a UTSW 17 26215308 missense probably damaging 1.00
R1971:Fam234a UTSW 17 26216655 unclassified probably null
R2016:Fam234a UTSW 17 26218316 missense probably benign 0.07
R3826:Fam234a UTSW 17 26218189 missense probably benign
R3827:Fam234a UTSW 17 26218189 missense probably benign
R3829:Fam234a UTSW 17 26218189 missense probably benign
R4133:Fam234a UTSW 17 26213558 missense probably damaging 0.99
R4190:Fam234a UTSW 17 26213860 missense probably damaging 0.98
R4193:Fam234a UTSW 17 26213860 missense probably damaging 0.98
R4858:Fam234a UTSW 17 26216617 missense probably benign
R4885:Fam234a UTSW 17 26213585 missense probably benign 0.00
R5117:Fam234a UTSW 17 26213538 missense probably benign 0.18
R5735:Fam234a UTSW 17 26213705 missense probably damaging 1.00
R6271:Fam234a UTSW 17 26218237 missense probably benign 0.19
R6341:Fam234a UTSW 17 26213693 missense probably damaging 1.00
R6365:Fam234a UTSW 17 26220455 nonsense probably null
R6621:Fam234a UTSW 17 26213881 missense probably damaging 1.00
R7393:Fam234a UTSW 17 26216624 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGATAGACCCAGTACTGAGGTC -3'
(R):5'- CTCACTCTGGGTCTCAGTGTAG -3'

Sequencing Primer
(F):5'- CCCAGTACTGAGGTCCAGAAG -3'
(R):5'- GGTAGCTCCATTTCAATTCAGGAGC -3'
Posted On2017-12-01