Incidental Mutation 'R5732:Pacsin3'
ID501394
Institutional Source Beutler Lab
Gene Symbol Pacsin3
Ensembl Gene ENSMUSG00000027257
Gene Nameprotein kinase C and casein kinase substrate in neurons 3
Synonyms
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91255954-91264679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91260260 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 18 (E18G)
Ref Sequence ENSEMBL: ENSMUSP00000129175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028694] [ENSMUST00000059566] [ENSMUST00000080008] [ENSMUST00000111349] [ENSMUST00000131711] [ENSMUST00000134699] [ENSMUST00000138470] [ENSMUST00000144394] [ENSMUST00000154959] [ENSMUST00000156919] [ENSMUST00000168916]
Predicted Effect probably damaging
Transcript: ENSMUST00000028694
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028694
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059566
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054391
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080008
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111349
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106981
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126754
Predicted Effect probably benign
Transcript: ENSMUST00000128684
SMART Domains Protein: ENSMUSP00000118915
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
PDB:3SYV|H 2 61 3e-37 PDB
low complexity region 62 74 N/A INTRINSIC
SCOP:d1k4us_ 86 112 6e-7 SMART
PDB:2X3X|E 88 112 7e-7 PDB
Blast:SH3 91 112 1e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131711
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117214
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134699
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115046
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138470
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117230
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143883
Predicted Effect probably damaging
Transcript: ENSMUST00000144394
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121297
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 95 4.88e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154959
AA Change: E18G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122769
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
Pfam:FCH 14 64 2.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156919
AA Change: E18G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122779
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168916
AA Change: E18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129175
Gene: ENSMUSG00000027257
AA Change: E18G

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180732
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Pacsin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pacsin3 APN 2 91263776 missense probably benign
IGL03071:Pacsin3 APN 2 91260492 missense probably damaging 0.99
IGL03149:Pacsin3 APN 2 91261507 splice site probably benign
pacifica UTSW 2 91262941 splice site probably null
R1179:Pacsin3 UTSW 2 91263860 missense probably damaging 1.00
R1765:Pacsin3 UTSW 2 91263115 missense possibly damaging 0.94
R3927:Pacsin3 UTSW 2 91262941 splice site probably null
R4472:Pacsin3 UTSW 2 91262943 splice site probably null
R5699:Pacsin3 UTSW 2 91262781 missense probably damaging 1.00
R5721:Pacsin3 UTSW 2 91264235 missense probably damaging 1.00
R6213:Pacsin3 UTSW 2 91260434 missense probably damaging 1.00
R6449:Pacsin3 UTSW 2 91260169 critical splice acceptor site probably null
R6541:Pacsin3 UTSW 2 91262784 missense probably damaging 1.00
R6834:Pacsin3 UTSW 2 91262835 missense probably damaging 1.00
R8513:Pacsin3 UTSW 2 91262805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAGCTTTGGACTACTAGAAGGC -3'
(R):5'- CGTTCTTGGAAGCAGCTAACC -3'

Sequencing Primer
(F):5'- TGGACTACTAGAAGGCCTCTTC -3'
(R):5'- TTCTTGGAAGCAGCTAACCAGGTC -3'
Posted On2017-12-01