Incidental Mutation 'R5733:Mpzl1'
ID501398
Institutional Source Beutler Lab
Gene Symbol Mpzl1
Ensembl Gene ENSMUSG00000026566
Gene Namemyelin protein zero-like 1
Synonyms1110007A10Rik
MMRRC Submission 043193-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5733 (G1)
Quality Score203
Status Not validated
Chromosome1
Chromosomal Location165592240-165634538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165605611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 157 (I157K)
Ref Sequence ENSEMBL: ENSMUSP00000141463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068705] [ENSMUST00000111435] [ENSMUST00000191818] [ENSMUST00000193023] [ENSMUST00000193910] [ENSMUST00000194437]
Predicted Effect probably benign
Transcript: ENSMUST00000068705
AA Change: I157K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070343
Gene: ENSMUSG00000026566
AA Change: I157K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
IGv 53 137 1.28e-10 SMART
transmembrane domain 162 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111435
AA Change: I157K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107062
Gene: ENSMUSG00000026566
AA Change: I157K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IGv 53 137 1.28e-10 SMART
transmembrane domain 162 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191818
AA Change: I131K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141361
Gene: ENSMUSG00000026566
AA Change: I131K

DomainStartEndE-ValueType
IGv 27 111 5.3e-13 SMART
transmembrane domain 134 165 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192848
Predicted Effect probably benign
Transcript: ENSMUST00000193023
AA Change: I157K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141463
Gene: ENSMUSG00000026566
AA Change: I157K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IGv 53 137 5.3e-13 SMART
transmembrane domain 162 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193172
Predicted Effect probably benign
Transcript: ENSMUST00000193910
Predicted Effect unknown
Transcript: ENSMUST00000193948
AA Change: I62K
Predicted Effect probably benign
Transcript: ENSMUST00000194437
SMART Domains Protein: ENSMUSP00000142164
Gene: ENSMUSG00000026566

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Blast:IGv 53 86 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194829
Predicted Effect unknown
Transcript: ENSMUST00000195410
AA Change: I101K
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,245,080 S76T probably damaging Het
Acox3 T A 5: 35,605,199 probably null Het
Ahnak2 A T 12: 112,775,666 Y657* probably null Het
Anxa3 T A 5: 96,820,472 I128N probably damaging Het
Bsnd T C 4: 106,488,001 T83A probably benign Het
Capn10 A G 1: 92,943,913 Y411C probably benign Het
Capn3 G A 2: 120,484,594 W201* probably null Het
Crtap T C 9: 114,378,096 T365A probably benign Het
Daam1 A G 12: 71,945,498 D329G unknown Het
Dmxl2 A T 9: 54,376,266 L2761Q possibly damaging Het
Dpcr1 T C 17: 35,638,210 M166V probably benign Het
Fcho2 A C 13: 98,789,802 V91G probably damaging Het
Fen1 A T 19: 10,200,658 C141S possibly damaging Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Frmd4a A T 2: 4,300,957 R14S possibly damaging Het
Fzr1 A G 10: 81,370,326 F176L possibly damaging Het
Garem2 A G 5: 30,116,338 D565G probably damaging Het
Iqca G T 1: 90,070,535 T549K probably damaging Het
Itgax T A 7: 128,140,475 S686R probably damaging Het
Knop1 C A 7: 118,846,082 G220C probably damaging Het
Lyzl1 T A 18: 4,169,142 C49S probably damaging Het
Mrgprb2 T C 7: 48,552,513 I155V probably benign Het
Mvb12b T C 2: 33,827,716 T167A probably benign Het
Myh3 A G 11: 67,088,619 N491S probably benign Het
Myo5b A G 18: 74,654,057 D511G possibly damaging Het
Olfr1053 T G 2: 86,315,214 Q24P probably damaging Het
Olfr1329 C T 4: 118,916,838 V210I probably benign Het
Olfr449 C T 6: 42,838,246 R122C probably damaging Het
Olfr749 T C 14: 50,737,052 T37A probably benign Het
Ptcd1 A G 5: 145,154,861 M476T probably damaging Het
Pum3 A G 19: 27,421,295 probably null Het
Ranbp2 G A 10: 58,485,836 D2652N probably damaging Het
Rassf1 T C 9: 107,558,014 V166A probably damaging Het
Rictor A G 15: 6,783,104 H907R probably benign Het
Rorb T C 19: 18,988,107 E6G probably damaging Het
Serpina3f A T 12: 104,216,923 T15S possibly damaging Het
Sorbs2 T C 8: 45,759,189 L100P probably damaging Het
Sprr2k T C 3: 92,433,348 probably benign Het
Srrm2 T A 17: 23,821,386 S2431T probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Ttc21a G A 9: 119,941,261 V133I probably benign Het
Vasn T C 16: 4,650,162 Y658H possibly damaging Het
Zfp251 A G 15: 76,870,327 Y35H probably damaging Het
Other mutations in Mpzl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Mpzl1 APN 1 165605822 missense probably damaging 0.99
IGL01294:Mpzl1 APN 1 165593608 missense probably damaging 1.00
IGL01388:Mpzl1 APN 1 165605767 missense probably benign 0.44
IGL01594:Mpzl1 APN 1 165593592 missense probably damaging 1.00
R0517:Mpzl1 UTSW 1 165601790 missense probably damaging 0.98
R1913:Mpzl1 UTSW 1 165601805 missense probably benign
R4352:Mpzl1 UTSW 1 165605807 nonsense probably null
R4997:Mpzl1 UTSW 1 165601781 missense probably damaging 0.98
R5097:Mpzl1 UTSW 1 165605716 missense probably damaging 1.00
R7084:Mpzl1 UTSW 1 165604698 missense probably benign 0.00
R7480:Mpzl1 UTSW 1 165604688 missense possibly damaging 0.77
X0065:Mpzl1 UTSW 1 165604646 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGGAGTTTGAAACATCCATG -3'
(R):5'- TCACAAGGACAGGTGTACATTGG -3'

Sequencing Primer
(F):5'- CAAAGCAGAccatccatc -3'
(R):5'- ACAGGTGTACATTGGGGATTATCCAC -3'
Posted On2017-12-01