Incidental Mutation 'R5772:4931406P16Rik'
ID501404
Institutional Source Beutler Lab
Gene Symbol 4931406P16Rik
Ensembl Gene ENSMUSG00000066571
Gene NameRIKEN cDNA 4931406P16 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5772 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34236707-34313551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34253988 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 238 (W238R)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000105172] [ENSMUST00000108074] [ENSMUST00000206399]
Predicted Effect probably damaging
Transcript: ENSMUST00000085592
AA Change: W450R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: W450R

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105172
SMART Domains Protein: ENSMUSP00000100805
Gene: ENSMUSG00000078380

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 13 62 1.1e-20 PFAM
Pfam:Ribosomal_L23 70 142 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108074
AA Change: W450R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: W450R

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205581
Predicted Effect probably damaging
Transcript: ENSMUST00000206399
AA Change: W238R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207005
Meta Mutation Damage Score 0.8048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932416K20Rik G A 8: 104,797,639 noncoding transcript Het
Abcg8 A T 17: 84,686,699 E48V probably damaging Het
Afap1l2 T C 19: 56,922,974 T289A probably benign Het
Atf6 T A 1: 170,747,189 D560V probably damaging Het
Bcl2l14 A T 6: 134,427,399 K183N probably damaging Het
Carmil3 T C 14: 55,493,239 L52P probably damaging Het
Cct3 T A 3: 88,300,967 N61K probably damaging Het
Col18a1 A G 10: 77,166,343 V10A unknown Het
Col26a1 G A 5: 136,847,566 Q67* probably null Het
Cyp2d34 T C 15: 82,617,140 D329G probably null Het
Dchs1 T A 7: 105,773,040 I58F probably damaging Het
Ddx60 T C 8: 61,948,897 L269P probably damaging Het
Dis3l2 G A 1: 86,878,432 G325D probably damaging Het
Dync1h1 A T 12: 110,646,273 K2861* probably null Het
Ednra A G 8: 77,675,067 I198T possibly damaging Het
Ep300 T C 15: 81,639,914 probably benign Het
Fam120a G A 13: 48,880,933 P1068S probably benign Het
Fsip2 A T 2: 82,984,740 M3606L probably benign Het
Gm7713 T C 15: 59,994,643 noncoding transcript Het
Gm9833 A G 3: 10,088,506 R112G probably damaging Het
Gprin3 A T 6: 59,354,413 V303D possibly damaging Het
Hmcn1 A T 1: 150,694,878 V2178D possibly damaging Het
Hoxa11 A G 6: 52,245,400 V107A possibly damaging Het
Iqub C A 6: 24,454,251 M544I possibly damaging Het
Itgb4 A T 11: 115,988,432 probably benign Het
Itpkb A G 1: 180,334,253 probably benign Het
Kalrn A T 16: 33,975,820 V1195E probably damaging Het
Kif12 C A 4: 63,165,941 R608M probably damaging Het
Lcorl A T 5: 45,795,367 probably null Het
Lrrc24 T C 15: 76,722,710 E162G probably damaging Het
Med6 A G 12: 81,579,644 S119P probably damaging Het
Mmab A C 5: 114,436,714 L166R probably damaging Het
Nom1 A G 5: 29,446,875 K737R possibly damaging Het
Obscn T C 11: 59,056,144 S4352G probably damaging Het
Olfr1130 A T 2: 87,608,173 T262S probably benign Het
Olfr1277 A T 2: 111,269,712 Y218* probably null Het
Olfr212 A C 6: 116,515,951 D58A possibly damaging Het
Olfr225 T A 11: 59,613,886 D307E probably benign Het
Pdzrn3 G A 6: 101,172,314 S351L probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Prkdc T A 16: 15,779,388 I2804K possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Resp18 A G 1: 75,274,000 V145A possibly damaging Het
Rgl3 T C 9: 21,981,612 M259V probably benign Het
Rhot2 A T 17: 25,839,807 S540T probably benign Het
Ring1 T C 17: 34,022,308 Y278C possibly damaging Het
Rpn2 A G 2: 157,295,345 Y216C probably damaging Het
Scgb2b18 G A 7: 33,173,830 L5F unknown Het
Slamf7 T C 1: 171,639,270 probably null Het
Slc22a12 T C 19: 6,540,449 N237S possibly damaging Het
Spen A T 4: 141,478,184 V1044D unknown Het
Sqor A T 2: 122,809,341 M175L probably benign Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tarsl2 T G 7: 65,684,125 F632V probably damaging Het
Tln1 A G 4: 43,545,191 V1008A probably benign Het
Tmem145 A G 7: 25,315,614 H554R probably benign Het
Trank1 A T 9: 111,366,676 D1256V possibly damaging Het
Trbv19 A G 6: 41,178,860 Y55C possibly damaging Het
Ttc23l C T 15: 10,551,469 C57Y probably benign Het
Uap1 A T 1: 170,161,380 C158S probably benign Het
Zfp353-ps T A 8: 42,082,610 noncoding transcript Het
Zfp629 T A 7: 127,611,135 I501F probably damaging Het
Zfp820 T C 17: 21,818,721 Y542C probably damaging Het
Other mutations in 4931406P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:4931406P16Rik APN 7 34245987 splice site probably benign
IGL00160:4931406P16Rik APN 7 34239006 missense possibly damaging 0.88
IGL00691:4931406P16Rik APN 7 34245485 missense probably damaging 1.00
IGL01312:4931406P16Rik APN 7 34256508 missense probably benign 0.19
IGL01954:4931406P16Rik APN 7 34245035 missense probably damaging 1.00
IGL02016:4931406P16Rik APN 7 34239101 missense possibly damaging 0.74
IGL02390:4931406P16Rik APN 7 34248218 missense probably damaging 1.00
IGL02407:4931406P16Rik APN 7 34256484 missense probably damaging 0.99
IGL02677:4931406P16Rik APN 7 34242409 splice site probably benign
IGL02929:4931406P16Rik APN 7 34245082 missense possibly damaging 0.46
IGL03285:4931406P16Rik APN 7 34284991 missense possibly damaging 0.81
I1329:4931406P16Rik UTSW 7 34245194 missense probably benign 0.00
R0004:4931406P16Rik UTSW 7 34256428 missense probably damaging 0.99
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0135:4931406P16Rik UTSW 7 34245957 missense probably damaging 1.00
R0137:4931406P16Rik UTSW 7 34239219 missense probably damaging 1.00
R0556:4931406P16Rik UTSW 7 34239797 missense probably damaging 0.99
R0687:4931406P16Rik UTSW 7 34245418 missense possibly damaging 0.95
R0928:4931406P16Rik UTSW 7 34248246 splice site probably null
R1719:4931406P16Rik UTSW 7 34248206 missense probably damaging 0.98
R1908:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1909:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1976:4931406P16Rik UTSW 7 34257380 missense probably damaging 0.99
R2496:4931406P16Rik UTSW 7 34256491 missense possibly damaging 0.93
R3005:4931406P16Rik UTSW 7 34284784 missense probably damaging 1.00
R4666:4931406P16Rik UTSW 7 34284773 missense probably damaging 0.98
R4832:4931406P16Rik UTSW 7 34238908 utr 3 prime probably benign
R4870:4931406P16Rik UTSW 7 34284887 missense possibly damaging 0.83
R4989:4931406P16Rik UTSW 7 34245800 missense probably damaging 1.00
R5033:4931406P16Rik UTSW 7 34245812 missense probably benign
R5308:4931406P16Rik UTSW 7 34245755 nonsense probably null
R5366:4931406P16Rik UTSW 7 34242288 missense possibly damaging 0.74
R5386:4931406P16Rik UTSW 7 34242388 missense probably damaging 0.99
R5688:4931406P16Rik UTSW 7 34253991 missense possibly damaging 0.74
R5688:4931406P16Rik UTSW 7 34284709 missense probably damaging 0.99
R5714:4931406P16Rik UTSW 7 34240516 nonsense probably null
R5733:4931406P16Rik UTSW 7 34245080 missense probably damaging 0.99
R6059:4931406P16Rik UTSW 7 34245463 missense possibly damaging 0.90
R6211:4931406P16Rik UTSW 7 34239004 missense possibly damaging 0.95
R6276:4931406P16Rik UTSW 7 34242377 nonsense probably null
R6477:4931406P16Rik UTSW 7 34257630 critical splice donor site probably null
R6757:4931406P16Rik UTSW 7 34239077 missense possibly damaging 0.89
R6912:4931406P16Rik UTSW 7 34245668 missense probably benign
R7156:4931406P16Rik UTSW 7 34245708 missense possibly damaging 0.80
R7317:4931406P16Rik UTSW 7 34263647 missense probably benign
R7431:4931406P16Rik UTSW 7 34284794 missense possibly damaging 0.73
R7452:4931406P16Rik UTSW 7 34245671 missense probably benign
R7996:4931406P16Rik UTSW 7 34263599 missense possibly damaging 0.77
RF019:4931406P16Rik UTSW 7 34240549 missense probably damaging 0.98
X0021:4931406P16Rik UTSW 7 34245363 missense possibly damaging 0.94
Z1177:4931406P16Rik UTSW 7 34284755 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTATATGCCAGTTGCCTGTGG -3'
(R):5'- AGACAGTTCTGCCGGTTACTG -3'

Sequencing Primer
(F):5'- GGTCAAAGGAGCTCTTTCTCAG -3'
(R):5'- CCGGTTACTGAGTGACTAATACGC -3'
Posted On2017-12-01