Incidental Mutation 'R5736:Tmem71'
ID 501408
Institutional Source Beutler Lab
Gene Symbol Tmem71
Ensembl Gene ENSMUSG00000036944
Gene Name transmembrane protein 71
Synonyms
MMRRC Submission 043194-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5736 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 66398061-66432952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66404496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 264 (V264I)
Ref Sequence ENSEMBL: ENSMUSP00000044493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048372]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048372
AA Change: V264I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044493
Gene: ENSMUSG00000036944
AA Change: V264I

DomainStartEndE-ValueType
Pfam:TMEM71 1 152 1.9e-85 PFAM
low complexity region 153 165 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik G A 1: 75,197,211 (GRCm39) probably benign Het
Akt1 G A 12: 112,623,284 (GRCm39) R367C probably benign Het
Arl8a T A 1: 135,082,458 (GRCm39) S150T probably benign Het
B020004C17Rik A T 14: 57,254,823 (GRCm39) T216S possibly damaging Het
Casz1 G A 4: 149,013,867 (GRCm39) V144I probably benign Het
Cd274 G T 19: 29,359,940 (GRCm39) L248F probably benign Het
Crisp4 T C 1: 18,185,939 (GRCm39) T266A probably benign Het
Dlx6 A T 6: 6,863,660 (GRCm39) H94L probably damaging Het
Exoc1 A G 5: 76,685,615 (GRCm39) N109S possibly damaging Het
Grik2 T C 10: 49,280,506 (GRCm39) E128G probably damaging Het
Hs3st4 G A 7: 123,996,662 (GRCm39) E443K probably damaging Het
Ihh T C 1: 74,985,286 (GRCm39) T400A probably benign Het
Lamb1 T A 12: 31,352,664 (GRCm39) C806* probably null Het
Lrrn1 T C 6: 107,544,345 (GRCm39) S48P probably damaging Het
Lsm11 T C 11: 45,835,594 (GRCm39) N49S possibly damaging Het
Map3k11 C T 19: 5,746,739 (GRCm39) A507V probably damaging Het
Mill2 A T 7: 18,592,174 (GRCm39) Q265L probably benign Het
Odad2 T C 18: 7,268,416 (GRCm39) T368A probably benign Het
Or4s2b T C 2: 88,508,985 (GRCm39) M255T probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Peg10 T A 6: 4,754,423 (GRCm39) L68Q probably benign Het
Phka2 ACC AC X: 159,342,862 (GRCm39) probably null Het
Prkag2 A T 5: 25,083,720 (GRCm39) Y88N probably damaging Het
Prmt5 A C 14: 54,752,297 (GRCm39) D166E probably null Het
Robo4 A T 9: 37,316,093 (GRCm39) T366S possibly damaging Het
Samd3 T C 10: 26,146,070 (GRCm39) I365T probably damaging Het
Sdf2l1 A T 16: 16,949,571 (GRCm39) C92S probably damaging Het
Serpinb6e A G 13: 34,016,753 (GRCm39) F327L probably damaging Het
Slc17a6 G A 7: 51,294,841 (GRCm39) V183I possibly damaging Het
Slc6a11 T C 6: 114,139,123 (GRCm39) S244P probably damaging Het
Slc6a5 A G 7: 49,609,102 (GRCm39) D769G probably benign Het
Slc7a14 A T 3: 31,278,059 (GRCm39) D515E probably benign Het
Slco2a1 A T 9: 102,945,029 (GRCm39) S135C probably benign Het
Spidr A T 16: 15,715,162 (GRCm39) D801E probably damaging Het
Spta1 T C 1: 174,041,821 (GRCm39) probably null Het
Zfp563 G T 17: 33,323,960 (GRCm39) R185L possibly damaging Het
Zfp941 G A 7: 140,392,973 (GRCm39) P129S probably benign Het
Other mutations in Tmem71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Tmem71 APN 15 66,426,874 (GRCm39) splice site probably benign
IGL02517:Tmem71 APN 15 66,413,466 (GRCm39) missense probably benign
R1766:Tmem71 UTSW 15 66,413,548 (GRCm39) missense probably benign 0.00
R2321:Tmem71 UTSW 15 66,423,849 (GRCm39) missense possibly damaging 0.73
R4965:Tmem71 UTSW 15 66,410,710 (GRCm39) missense probably benign
R5180:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R5181:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R5324:Tmem71 UTSW 15 66,427,063 (GRCm39) missense probably benign 0.01
R6684:Tmem71 UTSW 15 66,413,539 (GRCm39) missense possibly damaging 0.74
R8278:Tmem71 UTSW 15 66,426,961 (GRCm39) missense probably damaging 1.00
R8443:Tmem71 UTSW 15 66,413,421 (GRCm39) critical splice donor site probably null
R8808:Tmem71 UTSW 15 66,410,655 (GRCm39) missense possibly damaging 0.87
R8906:Tmem71 UTSW 15 66,404,606 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTCCATGTAGCTCTTACTTAGCAG -3'
(R):5'- CACTGCATGTGCTGGAAATTCAG -3'

Sequencing Primer
(F):5'- GCAGAAGTACCATTTCTTACTTAGC -3'
(R):5'- GCTGGAAATTCAGGGTTAATATGC -3'
Posted On 2017-12-01