Incidental Mutation 'R5711:Rxfp1'
ID501435
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 043185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5711 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79678747 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 96 (C96Y)
Ref Sequence ENSEMBL: ENSMUSP00000138578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect probably benign
Transcript: ENSMUST00000078527
AA Change: M131I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: M131I

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182345
Predicted Effect probably damaging
Transcript: ENSMUST00000182491
AA Change: C96Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009
AA Change: C96Y

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,654,214 T18S probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap19 A G 19: 41,784,788 V275A possibly damaging Het
Cebpz T A 17: 78,934,611 Q538L probably damaging Het
Chgb A T 2: 132,792,698 I187F probably benign Het
Cldn1 C A 16: 26,371,417 L70F probably damaging Het
Crybg2 A T 4: 134,082,627 D1230V probably damaging Het
Csmd1 C T 8: 15,953,703 C2617Y probably damaging Het
D7Ertd443e T A 7: 134,349,381 N188Y probably benign Het
Ddx51 A G 5: 110,654,924 I214M probably benign Het
Dlg5 A G 14: 24,150,648 V1328A probably damaging Het
Dnah2 C T 11: 69,435,390 C3639Y probably damaging Het
Dync1i2 C T 2: 71,250,982 T511I probably benign Het
Fam220a A T 5: 143,563,457 E208V probably damaging Het
Gm11492 T C 11: 87,567,897 S366P probably benign Het
Gm4846 T C 1: 166,484,025 S422G probably benign Het
Grin2c C T 11: 115,250,289 R1001Q probably benign Het
H2-T3 T C 17: 36,187,409 E248G probably damaging Het
Idi2 T C 13: 8,958,482 V92A probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Klhl26 T C 8: 70,452,324 D278G probably damaging Het
Mok G T 12: 110,808,069 T228K probably damaging Het
Olfr381 A G 11: 73,486,182 I214T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pabpc1 T C 15: 36,605,830 I101V probably benign Het
Ppargc1a G T 5: 51,474,220 Q356K probably damaging Het
Ptprt T A 2: 161,810,604 D608V probably damaging Het
Scn11a A C 9: 119,789,924 V784G probably damaging Het
Slc12a8 A G 16: 33,590,309 Y226C probably damaging Het
Slc25a33 A G 4: 149,762,457 V49A possibly damaging Het
Slc25a45 T C 19: 5,884,423 S140P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Spty2d1 G T 7: 46,998,097 N361K possibly damaging Het
Stk4 G A 2: 164,099,754 A297T probably benign Het
Thsd7b T A 1: 129,760,402 N683K probably damaging Het
Tln2 T C 9: 67,392,547 E141G probably benign Het
Tmem125 A T 4: 118,542,019 C72S probably damaging Het
Ttn G T 2: 76,742,093 T26152K probably damaging Het
Uhrf1 G A 17: 56,320,259 G643D possibly damaging Het
Vmn2r50 C T 7: 10,040,372 M532I possibly damaging Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0123:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79644975 missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79682535 missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79705569 splice site probably null
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79644761 missense probably benign
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79650461 missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79648090 missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79670907 missense possibly damaging 0.66
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTCTTCAGCTAAGGG -3'
(R):5'- CTCCCAGACTGACTTGGAGAAAG -3'

Sequencing Primer
(F):5'- GCTAAGGGATAAATACTTTCTCGAGG -3'
(R):5'- AGAAAGTGTGACTAGTCAGGCTTTC -3'
Posted On2017-12-01