Incidental Mutation 'R5711:Tmem125'
ID501436
Institutional Source Beutler Lab
Gene Symbol Tmem125
Ensembl Gene ENSMUSG00000050854
Gene Nametransmembrane protein 125
Synonyms
MMRRC Submission 043185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5711 (G1)
Quality Score213
Status Not validated
Chromosome4
Chromosomal Location118540941-118544044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118542019 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 72 (C72S)
Ref Sequence ENSEMBL: ENSMUSP00000117871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060214] [ENSMUST00000128098] [ENSMUST00000150044] [ENSMUST00000156191]
Predicted Effect probably damaging
Transcript: ENSMUST00000060214
AA Change: C72S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063157
Gene: ENSMUSG00000050854
AA Change: C72S

DomainStartEndE-ValueType
Pfam:TMEM125 15 125 1.7e-55 PFAM
transmembrane domain 143 165 N/A INTRINSIC
low complexity region 191 204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128098
AA Change: C72S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115304
Gene: ENSMUSG00000050854
AA Change: C72S

DomainStartEndE-ValueType
Pfam:TMEM125 14 125 4.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150044
AA Change: C72S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117871
Gene: ENSMUSG00000050854
AA Change: C72S

DomainStartEndE-ValueType
Pfam:TMEM125 14 72 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154025
Predicted Effect probably benign
Transcript: ENSMUST00000156191
SMART Domains Protein: ENSMUSP00000117286
Gene: ENSMUSG00000050854

DomainStartEndE-ValueType
Pfam:TMEM125 14 55 4.7e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,654,214 T18S probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap19 A G 19: 41,784,788 V275A possibly damaging Het
Cebpz T A 17: 78,934,611 Q538L probably damaging Het
Chgb A T 2: 132,792,698 I187F probably benign Het
Cldn1 C A 16: 26,371,417 L70F probably damaging Het
Crybg2 A T 4: 134,082,627 D1230V probably damaging Het
Csmd1 C T 8: 15,953,703 C2617Y probably damaging Het
D7Ertd443e T A 7: 134,349,381 N188Y probably benign Het
Ddx51 A G 5: 110,654,924 I214M probably benign Het
Dlg5 A G 14: 24,150,648 V1328A probably damaging Het
Dnah2 C T 11: 69,435,390 C3639Y probably damaging Het
Dync1i2 C T 2: 71,250,982 T511I probably benign Het
Fam220a A T 5: 143,563,457 E208V probably damaging Het
Gm11492 T C 11: 87,567,897 S366P probably benign Het
Gm4846 T C 1: 166,484,025 S422G probably benign Het
Grin2c C T 11: 115,250,289 R1001Q probably benign Het
H2-T3 T C 17: 36,187,409 E248G probably damaging Het
Idi2 T C 13: 8,958,482 V92A probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Klhl26 T C 8: 70,452,324 D278G probably damaging Het
Mok G T 12: 110,808,069 T228K probably damaging Het
Olfr381 A G 11: 73,486,182 I214T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pabpc1 T C 15: 36,605,830 I101V probably benign Het
Ppargc1a G T 5: 51,474,220 Q356K probably damaging Het
Ptprt T A 2: 161,810,604 D608V probably damaging Het
Rxfp1 C T 3: 79,678,747 C96Y probably damaging Het
Scn11a A C 9: 119,789,924 V784G probably damaging Het
Slc12a8 A G 16: 33,590,309 Y226C probably damaging Het
Slc25a33 A G 4: 149,762,457 V49A possibly damaging Het
Slc25a45 T C 19: 5,884,423 S140P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Spty2d1 G T 7: 46,998,097 N361K possibly damaging Het
Stk4 G A 2: 164,099,754 A297T probably benign Het
Thsd7b T A 1: 129,760,402 N683K probably damaging Het
Tln2 T C 9: 67,392,547 E141G probably benign Het
Ttn G T 2: 76,742,093 T26152K probably damaging Het
Uhrf1 G A 17: 56,320,259 G643D possibly damaging Het
Vmn2r50 C T 7: 10,040,372 M532I possibly damaging Het
Other mutations in Tmem125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Tmem125 APN 4 118541623 nonsense probably null
R0026:Tmem125 UTSW 4 118542073 missense possibly damaging 0.85
R1876:Tmem125 UTSW 4 118541904 missense probably damaging 1.00
Z1177:Tmem125 UTSW 4 118541839 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATGCCCACAGACAGCATGG -3'
(R):5'- AGTGATCCTCTGTCCTGACC -3'

Sequencing Primer
(F):5'- ACAGCATGGCAGCCAGTG -3'
(R):5'- ATGTCCCAGCAAGCCTCAGTG -3'
Posted On2017-12-01