Incidental Mutation 'R5726:Snap23'
ID501447
Institutional Source Beutler Lab
Gene Symbol Snap23
Ensembl Gene ENSMUSG00000027287
Gene Namesynaptosomal-associated protein 23
SynonymsSyndet, Sndt, SNAP-23
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120567671-120601255 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 120584271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028743] [ENSMUST00000110711] [ENSMUST00000116437] [ENSMUST00000142278] [ENSMUST00000150611] [ENSMUST00000153580]
Predicted Effect probably benign
Transcript: ENSMUST00000028743
SMART Domains Protein: ENSMUSP00000028743
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
t_SNARE 140 207 1.89e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110711
SMART Domains Protein: ENSMUSP00000106339
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
t_SNARE 140 207 1.89e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116437
SMART Domains Protein: ENSMUSP00000112138
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
t_SNARE 151 218 1.89e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137144
Predicted Effect probably benign
Transcript: ENSMUST00000142278
SMART Domains Protein: ENSMUSP00000116935
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
Pfam:SNAP-25 86 146 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147864
Predicted Effect probably benign
Transcript: ENSMUST00000150611
SMART Domains Protein: ENSMUSP00000119652
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153580
SMART Domains Protein: ENSMUSP00000121509
Gene: ENSMUSG00000027287

DomainStartEndE-ValueType
t_SNARE 9 76 3.44e-9 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Snap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Snap23 APN 2 120599311 missense probably damaging 1.00
IGL02804:Snap23 APN 2 120586156 splice site probably benign
R1844:Snap23 UTSW 2 120590682 missense probably benign
R2268:Snap23 UTSW 2 120599312 missense probably benign
R3755:Snap23 UTSW 2 120586245 missense probably damaging 1.00
R3904:Snap23 UTSW 2 120599334 missense possibly damaging 0.50
R4089:Snap23 UTSW 2 120584375 splice site probably benign
R4090:Snap23 UTSW 2 120585580 missense probably benign 0.00
R4112:Snap23 UTSW 2 120584375 splice site probably benign
R5509:Snap23 UTSW 2 120594865 missense probably benign 0.05
Z1177:Snap23 UTSW 2 120594850 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCCATTGGAAAGAATACTTCCC -3'
(R):5'- TGACTCACTTTTCTACTGTGAAAATGG -3'

Sequencing Primer
(F):5'- TAGATTCAGGTTCCAGCAGC -3'
(R):5'- TAGTGGCCTACAAATGGCTC -3'
Posted On2017-12-01