Incidental Mutation 'R5727:Cadps'
ID501455
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5727 (G1)
Quality Score220
Status Not validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 12486525 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 882 (Q882*)
Ref Sequence ENSEMBL: ENSMUSP00000064706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect probably null
Transcript: ENSMUST00000067491
AA Change: Q882*
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: Q882*

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112657
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112658
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177814
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224106
Predicted Effect probably benign
Transcript: ENSMUST00000224581
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1398:Cadps UTSW 14 12449822 missense probably damaging 1.00
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGGCTGATACAAAGTGACTGGAC -3'
(R):5'- GGCATGCTGAATGGTTAATCC -3'

Sequencing Primer
(F):5'- AAGTGACTGGACTTCTCACACTGG -3'
(R):5'- GTGTTTACCCCAAAATACTCTGTGG -3'
Posted On2017-12-01