Incidental Mutation 'R5731:N4bp2'
ID501466
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene NameNEDD4 binding protein 2
SynonymsB3bp, LOC333789, LOC386488
MMRRC Submission 043192-MU
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5731 (G1)
Quality Score214
Status Not validated
Chromosome5
Chromosomal Location65763521-65830108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65809157 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1313 (S1313P)
Ref Sequence ENSEMBL: ENSMUSP00000144278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: S1313P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: S1313P

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200843
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: S1313P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: S1313P

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: S1313P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: S1313P

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202411
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G18V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably null Het
Cd177 A G 7: 24,744,421 C751R probably damaging Het
Clcn3 T C 8: 60,922,889 I657V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably null Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Kit T A 5: 75,654,415 I933N possibly damaging Het
Klhl11 A T 11: 100,463,763 Y411N probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4515V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tlr3 A G 8: 45,398,120 V56A probably benign Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Ugt2b5 T A 5: 87,140,252 R19* probably null Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
IGL03046:N4bp2 UTSW 5 65790960 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 unclassified probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1735:N4bp2 UTSW 5 65808316 missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65806825 missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65808519 missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
R7103:N4bp2 UTSW 5 65806846 missense probably benign 0.01
R7112:N4bp2 UTSW 5 65790707 missense possibly damaging 0.74
R7171:N4bp2 UTSW 5 65808022 missense probably benign 0.00
R7177:N4bp2 UTSW 5 65807548 missense probably damaging 1.00
R7240:N4bp2 UTSW 5 65794545 missense probably damaging 0.96
R7353:N4bp2 UTSW 5 65806371 missense probably benign 0.01
R7450:N4bp2 UTSW 5 65825300 nonsense probably null
R7560:N4bp2 UTSW 5 65791115 missense probably damaging 0.99
R7698:N4bp2 UTSW 5 65808157 missense probably benign 0.00
R7743:N4bp2 UTSW 5 65808459 missense probably damaging 1.00
R7871:N4bp2 UTSW 5 65807103 missense probably benign 0.00
R7954:N4bp2 UTSW 5 65807103 missense probably benign 0.00
R8065:N4bp2 UTSW 5 65807296 missense not run
R8067:N4bp2 UTSW 5 65807296 missense not run
Z1177:N4bp2 UTSW 5 65807637 missense not run
Predicted Primers PCR Primer
(F):5'- TCGGGGCATGTGATAACTTAAATAG -3'
(R):5'- TGGCAAACAAGGCTACAGGC -3'

Sequencing Primer
(F):5'- TGAAAACAATGGCATAGGAC -3'
(R):5'- GTAATTCCAGGGGATCTGACACTC -3'
Posted On2017-12-01