Incidental Mutation 'R5744:Slc2a8'
ID501483
Institutional Source Beutler Lab
Gene Symbol Slc2a8
Ensembl Gene ENSMUSG00000026791
Gene Namesolute carrier family 2, (facilitated glucose transporter), member 8
SynonymsD2Ertd44e, GlutX1, GLUT8
MMRRC Submission 043197-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5744 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32972990-32982083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32976028 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 291 (D291N)
Ref Sequence ENSEMBL: ENSMUSP00000028129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028129] [ENSMUST00000153484] [ENSMUST00000193695] [ENSMUST00000194066] [ENSMUST00000195863]
Predicted Effect probably benign
Transcript: ENSMUST00000028129
AA Change: D291N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028129
Gene: ENSMUSG00000026791
AA Change: D291N

DomainStartEndE-ValueType
Pfam:MFS_1 26 425 2e-22 PFAM
Pfam:Sugar_tr 29 474 2.7e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130769
Predicted Effect probably benign
Transcript: ENSMUST00000153484
SMART Domains Protein: ENSMUSP00000141959
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:MFS_1 26 296 1.4e-18 PFAM
Pfam:Sugar_tr 29 295 1.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191777
Predicted Effect probably benign
Transcript: ENSMUST00000193695
SMART Domains Protein: ENSMUSP00000142100
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:MFS_1 26 290 1.2e-18 PFAM
Pfam:Sugar_tr 29 290 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194066
SMART Domains Protein: ENSMUSP00000141969
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195863
AA Change: D27N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141879
Gene: ENSMUSG00000026791
AA Change: D27N

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 60 8.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for one null allele show reduced spermatozoan ATP levels, mitochondrial membrane potential and sperm motility, and a slight deviation from the expected Mendelian frequency. Homozygotes for another null allele show increased hippocampus cell proliferation and cardiac P-wave duration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,346 I19V possibly damaging Het
Ascc3 T C 10: 50,710,881 I943T probably benign Het
Btaf1 T C 19: 37,004,490 V1640A probably benign Het
Cep250 T C 2: 155,981,474 F1015S possibly damaging Het
Cgnl1 G T 9: 71,630,675 probably null Het
Csgalnact2 C T 6: 118,126,236 G255E probably damaging Het
Ctla2a C T 13: 60,935,953 probably null Het
Dip2c A T 13: 9,568,405 I497F probably damaging Het
Eif3f C A 7: 108,938,417 T179K probably damaging Het
Frem2 A G 3: 53,655,959 F376L probably damaging Het
Gemin4 A T 11: 76,212,165 F590Y probably damaging Het
Gemin5 C A 11: 58,155,183 C433F possibly damaging Het
Gm7694 C T 1: 170,302,506 probably null Het
Gpr158 G A 2: 21,368,520 G89R probably damaging Het
Herc1 C T 9: 66,508,193 P4817S probably damaging Het
Hs6st3 T C 14: 119,138,440 L9P possibly damaging Het
Igdcc3 TGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGC 9: 65,141,488 probably benign Het
Il1rap A C 16: 26,680,224 I158L probably benign Het
Itpr2 A G 6: 146,376,151 S640P probably damaging Het
Metrn A G 17: 25,795,237 V205A probably damaging Het
Mfhas1 C A 8: 35,589,482 D370E probably damaging Het
Mn1 T C 5: 111,420,536 S791P possibly damaging Het
Mtmr3 A G 11: 4,487,679 V925A possibly damaging Het
Neil1 T C 9: 57,144,201 T278A probably damaging Het
Nol8 A G 13: 49,662,326 N619D possibly damaging Het
Nup214 T C 2: 32,010,296 L879P probably damaging Het
Olfr1353 T C 10: 78,970,183 F178S probably damaging Het
Olfr167 A G 16: 19,515,336 I100T probably benign Het
Olfr825 T C 10: 130,162,792 D178G possibly damaging Het
Plxna1 C T 6: 89,334,682 R947Q possibly damaging Het
Prdm16 A G 4: 154,528,704 S89P probably damaging Het
Reln A C 5: 22,106,083 S277R probably null Het
Sel1l A T 12: 91,809,980 I746N possibly damaging Het
Slc7a5 T C 8: 121,888,382 N242S probably benign Het
Smco3 T C 6: 136,831,765 N37S probably damaging Het
Sult1c1 T A 17: 53,973,962 K38* probably null Het
Tfap2b T C 1: 19,219,221 M190T probably benign Het
Tnpo2 T A 8: 85,051,894 Y623* probably null Het
Tomm70a G T 16: 57,121,839 probably benign Het
Ttyh2 T C 11: 114,702,310 probably null Het
Zbtb10 A G 3: 9,264,563 Y327C probably damaging Het
Other mutations in Slc2a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc2a8 APN 2 32973624 missense probably damaging 0.99
IGL01341:Slc2a8 APN 2 32975991 missense probably damaging 1.00
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0243:Slc2a8 UTSW 2 32980104 intron probably benign
R0530:Slc2a8 UTSW 2 32973684 missense probably benign 0.32
R0972:Slc2a8 UTSW 2 32975367 missense probably benign
R1919:Slc2a8 UTSW 2 32980079 missense probably damaging 1.00
R2015:Slc2a8 UTSW 2 32981380 missense probably benign 0.01
R2893:Slc2a8 UTSW 2 32974954 missense probably damaging 1.00
R5144:Slc2a8 UTSW 2 32981773 missense probably damaging 0.96
R5685:Slc2a8 UTSW 2 32981789 missense possibly damaging 0.87
R6717:Slc2a8 UTSW 2 32976177 missense probably damaging 1.00
X0061:Slc2a8 UTSW 2 32975448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCAAAAGAACCAGTCATAAAGG -3'
(R):5'- CATCGGCATTTCCCTCATGG -3'

Sequencing Primer
(F):5'- AGGATCACCTCCCTGGC -3'
(R):5'- TGGTCTTCCAGCAGCTGTCAG -3'
Posted On2017-12-01