Incidental Mutation 'R5745:Tafa1'
ID 501485
Institutional Source Beutler Lab
Gene Symbol Tafa1
Ensembl Gene ENSMUSG00000059187
Gene Name TAFA chemokine like family member 1
Synonyms Tafa-1, Fam19a1, C630007B19Rik
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 96090135-96634159 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 96626146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 128 (R128Q)
Ref Sequence ENSEMBL: ENSMUSP00000113152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000122120]
AlphaFold Q7TPG8
Predicted Effect probably damaging
Transcript: ENSMUST00000075080
AA Change: R128Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187
AA Change: R128Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122120
AA Change: R128Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187
AA Change: R128Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,828 (GRCm39) R74W probably damaging Het
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Cpa5 T A 6: 30,630,436 (GRCm39) M330K probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Pms1 A T 1: 53,246,861 (GRCm39) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Sema3b C A 9: 107,478,628 (GRCm39) A356S probably damaging Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tle3 C A 9: 61,322,133 (GRCm39) F719L probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in Tafa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2039:Tafa1 UTSW 6 96,631,725 (GRCm39) splice site probably null
R3420:Tafa1 UTSW 6 96,626,099 (GRCm39) missense probably damaging 1.00
R3421:Tafa1 UTSW 6 96,626,099 (GRCm39) missense probably damaging 1.00
R3422:Tafa1 UTSW 6 96,626,099 (GRCm39) missense probably damaging 1.00
R6175:Tafa1 UTSW 6 96,092,721 (GRCm39) missense probably benign 0.03
R7318:Tafa1 UTSW 6 96,092,737 (GRCm39) critical splice donor site probably null
R7746:Tafa1 UTSW 6 96,092,737 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCAGAGAACATTAAAACTGG -3'
(R):5'- CAGCAAGGTCGCCTTTAAAC -3'

Sequencing Primer
(F):5'- CCACATCAGAATACAGGGTTATTTGG -3'
(R):5'- CAGCAAGGTCGCCTTTAAACTTTAAC -3'
Posted On 2017-12-01