Incidental Mutation 'R5745:Fam19a1'
ID501485
Institutional Source Beutler Lab
Gene Symbol Fam19a1
Ensembl Gene ENSMUSG00000059187
Gene Namefamily with sequence similarity 19, member A1
SynonymsC630007B19Rik, Tafa-1
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location96113154-96657198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96649185 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 128 (R128Q)
Ref Sequence ENSEMBL: ENSMUSP00000113152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000122120]
Predicted Effect probably damaging
Transcript: ENSMUST00000075080
AA Change: R128Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187
AA Change: R128Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122120
AA Change: R128Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187
AA Change: R128Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Fam19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2039:Fam19a1 UTSW 6 96654764 splice site probably null
R3420:Fam19a1 UTSW 6 96649138 missense probably damaging 1.00
R3421:Fam19a1 UTSW 6 96649138 missense probably damaging 1.00
R3422:Fam19a1 UTSW 6 96649138 missense probably damaging 1.00
R6175:Fam19a1 UTSW 6 96115740 missense probably benign 0.03
R7318:Fam19a1 UTSW 6 96115756 critical splice donor site probably null
R7746:Fam19a1 UTSW 6 96115756 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCAGAGAACATTAAAACTGG -3'
(R):5'- CAGCAAGGTCGCCTTTAAAC -3'

Sequencing Primer
(F):5'- CCACATCAGAATACAGGGTTATTTGG -3'
(R):5'- CAGCAAGGTCGCCTTTAAACTTTAAC -3'
Posted On2017-12-01