Incidental Mutation 'R5749:Vmn2r23'
ID501489
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123733273 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 512 (T512A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: T512A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T512A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGGAGAGACTTGGGAAAGTT -3'
(R):5'- CATCCCTATACTGTGGTGCATT -3'

Sequencing Primer
(F):5'- GAGACTTGGGAAAGTTAAAGATCC -3'
(R):5'- GTGGTGCATTATTTCCACATTCAG -3'
Posted On2017-12-01