Incidental Mutation 'R5749:Vmn2r23'
ID 501489
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 043200-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123710232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 512 (T512A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: T512A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T512A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,214,881 (GRCm39) probably null Het
Ankrd12 T C 17: 66,293,091 (GRCm39) S781G probably benign Het
Bicc1 A G 10: 70,782,799 (GRCm39) S523P probably benign Het
Ccdc163 T A 4: 116,571,309 (GRCm39) C44* probably null Het
Ccdc83 T C 7: 89,873,156 (GRCm39) T400A probably damaging Het
Cobl A G 11: 12,216,965 (GRCm39) S426P possibly damaging Het
Cyp2b19 T C 7: 26,462,844 (GRCm39) I242T possibly damaging Het
Efnb2 A C 8: 8,689,347 (GRCm39) C92G probably damaging Het
Fam90a1a T A 8: 22,453,057 (GRCm39) S137R possibly damaging Het
Fbxo17 G A 7: 28,436,897 (GRCm39) R284H probably damaging Het
Fem1b A G 9: 62,704,288 (GRCm39) L324P probably damaging Het
Fsd1 T A 17: 56,302,849 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,045,983 (GRCm39) probably null Het
Ifi209 A C 1: 173,464,893 (GRCm39) I8L probably damaging Het
Itga8 T C 2: 12,266,889 (GRCm39) E182G probably damaging Het
Itsn1 T A 16: 91,703,743 (GRCm39) L87H probably damaging Het
Klk1b16 T C 7: 43,790,210 (GRCm39) I160T probably benign Het
Lbp T A 2: 158,161,673 (GRCm39) V52D probably damaging Het
Med23 T C 10: 24,764,347 (GRCm39) V318A possibly damaging Het
Myo16 C T 8: 10,463,245 (GRCm39) S604L probably benign Het
Or10ag52 C T 2: 87,043,287 (GRCm39) T17I probably benign Het
Or10g1 T A 14: 52,647,961 (GRCm39) M123L probably damaging Het
Or5b12 A G 19: 12,897,589 (GRCm39) V28A probably benign Het
Or6c38 A T 10: 128,928,966 (GRCm39) N292K probably damaging Het
Pcdh8 T C 14: 80,007,525 (GRCm39) D346G probably damaging Het
Ppara A T 15: 85,673,229 (GRCm39) D140V probably benign Het
Prlr T A 15: 10,328,804 (GRCm39) D426E probably benign Het
Prss36 T A 7: 127,532,814 (GRCm39) I192F probably damaging Het
Psg25 T C 7: 18,258,776 (GRCm39) E300G probably damaging Het
Pxylp1 A G 9: 96,738,424 (GRCm39) F26L possibly damaging Het
Rapgef4 A T 2: 72,073,101 (GRCm39) T796S probably damaging Het
Stard9 A G 2: 120,534,267 (GRCm39) H3508R probably damaging Het
Tep1 T A 14: 51,081,529 (GRCm39) D1282V possibly damaging Het
Tgfbr3l A G 8: 4,299,310 (GRCm39) E59G probably damaging Het
Tnik T C 3: 28,648,241 (GRCm39) M431T probably benign Het
Tns3 A T 11: 8,401,177 (GRCm39) H1040Q probably benign Het
Usp10 G A 8: 120,667,872 (GRCm39) E58K probably damaging Het
Vmn2r52 C T 7: 9,892,959 (GRCm39) D727N probably damaging Het
Vmn2r66 T A 7: 84,655,979 (GRCm39) K346* probably null Het
Vmn2r93 T A 17: 18,518,546 (GRCm39) F2I probably benign Het
Zfp697 T C 3: 98,332,780 (GRCm39) S69P probably benign Het
Zftraf1 A C 15: 76,542,844 (GRCm39) probably null Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGGAGAGACTTGGGAAAGTT -3'
(R):5'- CATCCCTATACTGTGGTGCATT -3'

Sequencing Primer
(F):5'- GAGACTTGGGAAAGTTAAAGATCC -3'
(R):5'- GTGGTGCATTATTTCCACATTCAG -3'
Posted On 2017-12-01