Mutagenetix > Incidental Mutation

Incidental Mutation 'R5749:Vmn2r23'

501489

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

043200-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123733273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 512 (T512A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158091

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: T512A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T512A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	G	A	11: 54,324,055		probably null	Het
Ankrd12	T	C	17: 65,986,096	S781G	probably benign	Het
Bicc1	A	G	10: 70,946,969	S523P	probably benign	Het
Ccdc163	T	A	4: 116,714,112	C44*	probably null	Het
Ccdc83	T	C	7: 90,223,948	T400A	probably damaging	Het
Cobl	A	G	11: 12,266,965	S426P	possibly damaging	Het
Cyhr1	A	C	15: 76,658,644		probably null	Het
Cyp2b19	T	C	7: 26,763,419	I242T	possibly damaging	Het
Efnb2	A	C	8: 8,639,347	C92G	probably damaging	Het
Fam90a1a	T	A	8: 21,963,041	S137R	possibly damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fem1b	A	G	9: 62,797,006	L324P	probably damaging	Het
Fsd1	T	A	17: 55,995,849		probably null	Het
Gtpbp4	A	G	13: 8,995,947		probably null	Het
Ifi209	A	C	1: 173,637,327	I8L	probably damaging	Het
Itga8	T	C	2: 12,262,078	E182G	probably damaging	Het
Itsn1	T	A	16: 91,906,855	L87H	probably damaging	Het
Klk1b16	T	C	7: 44,140,786	I160T	probably benign	Het
Lbp	T	A	2: 158,319,753	V52D	probably damaging	Het
Med23	T	C	10: 24,888,449	V318A	possibly damaging	Het
Myo16	C	T	8: 10,413,245	S604L	probably benign	Het
Olfr1113	C	T	2: 87,212,943	T17I	probably benign	Het
Olfr1448	A	G	19: 12,920,225	V28A	probably benign	Het
Olfr1510	T	A	14: 52,410,504	M123L	probably damaging	Het
Olfr768	A	T	10: 129,093,097	N292K	probably damaging	Het
Pcdh8	T	C	14: 79,770,085	D346G	probably damaging	Het
Ppara	A	T	15: 85,789,028	D140V	probably benign	Het
Prlr	T	A	15: 10,328,718	D426E	probably benign	Het
Prss36	T	A	7: 127,933,642	I192F	probably damaging	Het
Psg25	T	C	7: 18,524,851	E300G	probably damaging	Het
Pxylp1	A	G	9: 96,856,371	F26L	possibly damaging	Het
Rapgef4	A	T	2: 72,242,757	T796S	probably damaging	Het
Stard9	A	G	2: 120,703,786	H3508R	probably damaging	Het
Tep1	T	A	14: 50,844,072	D1282V	possibly damaging	Het
Tgfbr3l	A	G	8: 4,249,310	E59G	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Tns3	A	T	11: 8,451,177	H1040Q	probably benign	Het
Usp10	G	A	8: 119,941,133	E58K	probably damaging	Het
Vmn2r52	C	T	7: 10,159,032	D727N	probably damaging	Het
Vmn2r66	T	A	7: 85,006,771	K346*	probably null	Het
Vmn2r93	T	A	17: 18,298,284	F2I	probably benign	Het
Zfp697	T	C	3: 98,425,464	S69P	probably benign	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGGAGAGACTTGGGAAAGTT -3'
(R):5'- CATCCCTATACTGTGGTGCATT -3'

Sequencing Primer
(F):5'- GAGACTTGGGAAAGTTAAAGATCC -3'
(R):5'- GTGGTGCATTATTTCCACATTCAG -3'

Posted On

2017-12-01