Incidental Mutation 'R5766:Msh4'
ID 501500
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene Name mutS homolog 4
Synonyms mMsh4, 4930485C04Rik
MMRRC Submission 044424-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.562) question?
Stock # R5766 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 153562783-153611495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153573477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 726 (S726P)
Ref Sequence ENSEMBL: ENSMUSP00000005630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
AlphaFold Q99MT2
Predicted Effect probably damaging
Transcript: ENSMUST00000005630
AA Change: S726P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: S726P

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186220
Predicted Effect probably damaging
Transcript: ENSMUST00000188338
AA Change: S638P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: S638P

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189189
Predicted Effect probably damaging
Transcript: ENSMUST00000190449
AA Change: S532P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: S532P

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191083
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,182,439 (GRCm39) V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 37,461,383 (GRCm39) probably null Het
Arid2 A G 15: 96,270,086 (GRCm39) T1400A probably benign Het
Arrdc1 G A 2: 24,816,417 (GRCm39) T184I probably damaging Het
Aspm T C 1: 139,406,740 (GRCm39) F1876L probably damaging Het
Calhm1 C T 19: 47,132,142 (GRCm39) V158I probably benign Het
Caly T C 7: 139,650,310 (GRCm39) K211E probably benign Het
Cenpe T C 3: 134,954,174 (GRCm39) L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,032 (GRCm39) V1388A possibly damaging Het
Dgkd C T 1: 87,808,171 (GRCm39) R80* probably null Het
Dnah3 A T 7: 119,577,445 (GRCm39) I2072N probably damaging Het
Dnah8 A G 17: 30,909,235 (GRCm39) I1020M probably benign Het
Drc3 T C 11: 60,284,647 (GRCm39) V484A probably benign Het
Efcab8 A G 2: 153,622,912 (GRCm39) D27G possibly damaging Het
Fat4 G A 3: 38,943,617 (GRCm39) G837R probably damaging Het
Fcgbpl1 G A 7: 27,836,754 (GRCm39) W224* probably null Het
Fgb A T 3: 82,953,483 (GRCm39) C96S probably damaging Het
Flt4 G C 11: 49,517,513 (GRCm39) W278C possibly damaging Het
Fmnl2 T C 2: 52,991,466 (GRCm39) V327A probably damaging Het
Fras1 A T 5: 96,879,548 (GRCm39) Y2455F possibly damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm13872 T A 2: 102,568,254 (GRCm39) I88N probably damaging Het
Hoxa6 A G 6: 52,185,394 (GRCm39) S71P probably benign Het
Hunk T A 16: 90,250,627 (GRCm39) C148S probably damaging Het
Ighv1-18 A C 12: 114,646,527 (GRCm39) S26A probably damaging Het
Impg2 T G 16: 56,080,183 (GRCm39) D553E possibly damaging Het
Ints1 A G 5: 139,757,900 (GRCm39) I266T probably benign Het
Kpna3 G T 14: 61,640,463 (GRCm39) T33K probably benign Het
Lamb1 A G 12: 31,349,930 (GRCm39) D622G probably damaging Het
Lamp3 T C 16: 19,520,067 (GRCm39) T39A probably damaging Het
Mnt C T 11: 74,733,904 (GRCm39) probably benign Het
Or13a25 T A 7: 140,247,266 (GRCm39) V22E probably benign Het
Pah A C 10: 87,403,209 (GRCm39) K195Q probably damaging Het
Pdc T A 1: 150,209,251 (GRCm39) *245K probably null Het
Pdzd8 A T 19: 59,288,972 (GRCm39) H809Q possibly damaging Het
Plekhd1 A T 12: 80,769,140 (GRCm39) I467L probably benign Het
Ppp2ca A G 11: 52,004,014 (GRCm39) D57G probably damaging Het
Ralgapa1 A T 12: 55,867,551 (GRCm39) M1K probably null Het
Rfx2 T A 17: 57,110,587 (GRCm39) D133V probably benign Het
Scfd2 A T 5: 74,623,312 (GRCm39) L407Q probably damaging Het
Scp2d1 T A 2: 144,665,957 (GRCm39) S99T possibly damaging Het
Sec63 A T 10: 42,677,677 (GRCm39) N261I probably damaging Het
Slc8a1 T C 17: 81,956,390 (GRCm39) Y216C probably damaging Het
Son T A 16: 91,461,875 (GRCm39) probably benign Het
Syce1 T C 7: 140,357,894 (GRCm39) E285G probably damaging Het
Taar7a G T 10: 23,869,260 (GRCm39) S40R probably benign Het
Ube3a A T 7: 58,925,807 (GRCm39) D216V possibly damaging Het
Vgll2 A G 10: 51,903,659 (GRCm39) D174G probably damaging Het
Vmn2r17 A T 5: 109,575,139 (GRCm39) T149S possibly damaging Het
Zbtb39 G T 10: 127,578,557 (GRCm39) C377F probably damaging Het
Zfp820 T A 17: 22,038,983 (GRCm39) N115I probably damaging Het
Zfp948 T C 17: 21,805,078 (GRCm39) S23P probably benign Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153,589,372 (GRCm39) missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153,583,619 (GRCm39) splice site probably benign
IGL01609:Msh4 APN 3 153,603,034 (GRCm39) missense probably damaging 1.00
IGL01785:Msh4 APN 3 153,563,144 (GRCm39) missense probably damaging 1.00
IGL01939:Msh4 APN 3 153,563,226 (GRCm39) missense probably damaging 1.00
IGL02022:Msh4 APN 3 153,592,593 (GRCm39) missense probably damaging 1.00
IGL02209:Msh4 APN 3 153,594,499 (GRCm39) missense probably damaging 1.00
IGL02224:Msh4 APN 3 153,595,822 (GRCm39) missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153,579,311 (GRCm39) missense probably damaging 0.98
IGL02493:Msh4 APN 3 153,583,545 (GRCm39) critical splice donor site probably null
IGL02576:Msh4 APN 3 153,573,383 (GRCm39) missense probably damaging 1.00
IGL02616:Msh4 APN 3 153,563,160 (GRCm39) missense probably benign
IGL02812:Msh4 APN 3 153,607,037 (GRCm39) splice site probably benign
IGL02888:Msh4 APN 3 153,602,550 (GRCm39) nonsense probably null
IGL02992:Msh4 APN 3 153,577,962 (GRCm39) missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153,575,245 (GRCm39) missense probably damaging 0.97
P0021:Msh4 UTSW 3 153,594,455 (GRCm39) missense probably damaging 1.00
R0057:Msh4 UTSW 3 153,575,318 (GRCm39) missense probably benign 0.16
R0057:Msh4 UTSW 3 153,575,318 (GRCm39) missense probably benign 0.16
R0368:Msh4 UTSW 3 153,594,462 (GRCm39) missense probably damaging 1.00
R0377:Msh4 UTSW 3 153,602,527 (GRCm39) missense probably benign 0.00
R0631:Msh4 UTSW 3 153,572,057 (GRCm39) missense probably benign 0.02
R0632:Msh4 UTSW 3 153,602,532 (GRCm39) missense probably damaging 1.00
R0677:Msh4 UTSW 3 153,585,004 (GRCm39) missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153,569,141 (GRCm39) missense probably benign 0.00
R1081:Msh4 UTSW 3 153,577,995 (GRCm39) missense probably benign 0.06
R1463:Msh4 UTSW 3 153,563,207 (GRCm39) missense probably damaging 1.00
R1476:Msh4 UTSW 3 153,569,021 (GRCm39) missense probably damaging 1.00
R1669:Msh4 UTSW 3 153,582,357 (GRCm39) missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153,573,404 (GRCm39) missense probably damaging 1.00
R1859:Msh4 UTSW 3 153,611,517 (GRCm39) missense probably benign
R2168:Msh4 UTSW 3 153,573,472 (GRCm39) nonsense probably null
R2378:Msh4 UTSW 3 153,569,114 (GRCm39) missense probably damaging 0.99
R2991:Msh4 UTSW 3 153,611,497 (GRCm39) missense probably benign
R3025:Msh4 UTSW 3 153,569,128 (GRCm39) missense probably damaging 1.00
R4604:Msh4 UTSW 3 153,577,920 (GRCm39) missense probably damaging 1.00
R4757:Msh4 UTSW 3 153,585,024 (GRCm39) missense probably damaging 0.99
R5205:Msh4 UTSW 3 153,572,049 (GRCm39) missense probably damaging 1.00
R5285:Msh4 UTSW 3 153,579,350 (GRCm39) missense probably benign 0.03
R5777:Msh4 UTSW 3 153,569,076 (GRCm39) missense probably benign 0.01
R5888:Msh4 UTSW 3 153,573,360 (GRCm39) critical splice donor site probably null
R7384:Msh4 UTSW 3 153,594,385 (GRCm39) missense probably benign 0.23
R7408:Msh4 UTSW 3 153,582,382 (GRCm39) missense probably benign 0.06
R7487:Msh4 UTSW 3 153,569,147 (GRCm39) missense probably damaging 1.00
R7503:Msh4 UTSW 3 153,573,387 (GRCm39) missense probably damaging 1.00
R7726:Msh4 UTSW 3 153,571,957 (GRCm39) critical splice donor site probably null
R7990:Msh4 UTSW 3 153,602,529 (GRCm39) missense probably damaging 1.00
R8097:Msh4 UTSW 3 153,583,545 (GRCm39) critical splice donor site probably null
R8805:Msh4 UTSW 3 153,563,270 (GRCm39) missense probably benign 0.00
R8814:Msh4 UTSW 3 153,577,957 (GRCm39) missense probably damaging 1.00
R8861:Msh4 UTSW 3 153,607,105 (GRCm39) missense probably benign 0.04
R8970:Msh4 UTSW 3 153,575,369 (GRCm39) nonsense probably null
R9010:Msh4 UTSW 3 153,595,819 (GRCm39) missense probably benign 0.30
R9338:Msh4 UTSW 3 153,573,444 (GRCm39) missense possibly damaging 0.55
R9598:Msh4 UTSW 3 153,607,148 (GRCm39) missense possibly damaging 0.93
R9780:Msh4 UTSW 3 153,582,342 (GRCm39) missense probably damaging 1.00
Z1177:Msh4 UTSW 3 153,607,080 (GRCm39) start gained probably benign
Z1177:Msh4 UTSW 3 153,585,005 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGGCTCTCAGGAACTAAAGTG -3'
(R):5'- CAACCTTGTATGGCAGGTGC -3'

Sequencing Primer
(F):5'- GCACCAGCAAGTCTGAATGC -3'
(R):5'- CCACAGGCACTCGCTTC -3'
Posted On 2017-12-01