Incidental Mutation 'R5769:Ppp2r5a'
ID501506
Institutional Source Beutler Lab
Gene Symbol Ppp2r5a
Ensembl Gene ENSMUSG00000026626
Gene Nameprotein phosphatase 2, regulatory subunit B', alpha
Synonyms
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191351975-191403272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191372666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 61 (D61G)
Ref Sequence ENSEMBL: ENSMUSP00000070726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067976]
Predicted Effect probably benign
Transcript: ENSMUST00000067976
AA Change: D61G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000070726
Gene: ENSMUSG00000026626
AA Change: D61G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:B56 56 462 3.6e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195859
Meta Mutation Damage Score 0.1037 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Ppp2r5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03297:Ppp2r5a APN 1 191354762 missense probably benign 0.28
R1640:Ppp2r5a UTSW 1 191353929 missense probably damaging 0.99
R3005:Ppp2r5a UTSW 1 191358976 missense probably damaging 1.00
R4810:Ppp2r5a UTSW 1 191356392 unclassified probably benign
R5730:Ppp2r5a UTSW 1 191372535 missense probably benign 0.04
R5783:Ppp2r5a UTSW 1 191354640 missense probably damaging 0.98
R6215:Ppp2r5a UTSW 1 191362250 missense probably benign 0.02
R7311:Ppp2r5a UTSW 1 191357801 missense probably damaging 1.00
R7485:Ppp2r5a UTSW 1 191396335 missense probably benign 0.07
R7545:Ppp2r5a UTSW 1 191372609 missense probably benign 0.00
V5622:Ppp2r5a UTSW 1 191358992 missense probably damaging 1.00
V5622:Ppp2r5a UTSW 1 191359001 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACGCCTCAGATCTTTGCAC -3'
(R):5'- CAGCCTAGTGTAAATCCTTGTACG -3'

Sequencing Primer
(F):5'- AGGAATAGAAATCTAGAGGCTTACC -3'
(R):5'- CGAAAATATTACAGCTGCCTGG -3'
Posted On2017-12-01