Incidental Mutation 'R5699:Disp1'
ID501509
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Namedispatched RND transporter family member 1
Synonyms1190008H24Rik, DispA
MMRRC Submission 043327-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5699 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location183086266-183221522 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) TTGA to T at 183088555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
Predicted Effect probably null
Transcript: ENSMUST00000003035
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171366
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195372
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,225,319 noncoding transcript Het
4930486L24Rik A G 13: 60,853,596 F106L possibly damaging Het
Adam11 A T 11: 102,773,640 M385L probably benign Het
Adgre1 C T 17: 57,481,007 P925S probably benign Het
Adh7 G A 3: 138,226,326 A234T probably benign Het
Ano2 A G 6: 125,872,740 E475G probably damaging Het
BC055324 A T 1: 163,957,551 V753D probably benign Het
C2cd4c A G 10: 79,612,551 V254A probably benign Het
Car13 A G 3: 14,650,689 Y89C probably damaging Het
Cd38 A G 5: 43,900,386 K100R probably damaging Het
Cdh11 A G 8: 102,634,543 I721T probably damaging Het
Cdh2 G A 18: 16,646,522 Q161* probably null Het
Clk1 T C 1: 58,420,195 K135R probably damaging Het
Col5a1 G A 2: 27,997,599 G961R unknown Het
Cpt1b T A 15: 89,424,273 I151F probably benign Het
Cyp51 A G 5: 4,101,213 F139L probably damaging Het
Dnah8 T C 17: 30,810,324 I4089T probably benign Het
Dnali1 C T 4: 125,059,050 V227M possibly damaging Het
Eml4 T G 17: 83,410,085 S29A probably benign Het
Eps8l3 C A 3: 107,879,579 P24T probably benign Het
Fancc A T 13: 63,330,632 probably null Het
Grid2 G A 6: 63,908,991 A124T probably damaging Het
Ikbke C T 1: 131,276,467 probably null Het
Kyat1 G A 2: 30,186,650 A284V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmbrd2 G T 15: 9,175,182 L393F probably benign Het
Lrrc26 T A 2: 25,290,524 L179Q probably damaging Het
Mlx A G 11: 101,088,694 D113G possibly damaging Het
Myod1 A G 7: 46,376,983 K104R probably damaging Het
Nwd1 G A 8: 72,702,974 probably null Het
Olfr1474 A G 19: 13,470,972 M1V probably null Het
Olfr663 T G 7: 104,703,993 V142G probably damaging Het
Olfr788 A C 10: 129,472,877 N62H probably damaging Het
Pacsin3 A T 2: 91,262,781 Y206F probably damaging Het
Pcdhgb5 T A 18: 37,731,917 V255E probably damaging Het
Pdp1 T C 4: 11,960,907 D468G possibly damaging Het
Pgr C T 9: 8,900,599 probably benign Het
Prrt2 T A 7: 127,018,727 Y345F probably benign Het
Rbbp8nl T C 2: 180,278,668 T515A probably damaging Het
Rc3h1 G T 1: 160,930,253 R47L probably damaging Het
Rfpl4b T A 10: 38,821,285 I107F possibly damaging Het
Rsbn1 T C 3: 103,962,485 F754S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn3a T C 2: 65,507,264 T630A possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slco1a5 C A 6: 142,248,816 C367F probably damaging Het
Slit1 A G 19: 41,625,520 probably null Het
Slit2 G A 5: 48,220,991 probably null Het
Snrnp40 G T 4: 130,365,165 G122V possibly damaging Het
Stk16 T A 1: 75,213,604 M111K probably damaging Het
Tbc1d2 T C 4: 46,616,298 I477V probably benign Het
Tll1 T A 8: 64,117,940 E199D probably damaging Het
Trhde A T 10: 114,588,502 D459E probably benign Het
Ttn T C 2: 76,711,537 R25375G possibly damaging Het
Tubgcp2 A T 7: 139,998,788 M757K possibly damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ubqln5 A G 7: 104,129,425 V64A possibly damaging Het
Usp47 A G 7: 112,109,997 M1337V probably benign Het
Vmn1r201 T A 13: 22,475,239 Y208N probably damaging Het
Xkr8 C T 4: 132,728,057 R335H probably damaging Het
Zbtb49 A T 5: 38,216,526 C25S probably damaging Het
Zeb2 T A 2: 44,997,788 N404I probably damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 183135539 missense probably benign
BB016:Disp1 UTSW 1 183135539 missense probably benign
R1120:Disp1 UTSW 1 183098575 missense probably benign 0.24
R1482:Disp1 UTSW 1 183086474 missense possibly damaging 0.61
R1655:Disp1 UTSW 1 183087004 missense probably benign 0.01
R1660:Disp1 UTSW 1 183087742 missense probably damaging 1.00
R1816:Disp1 UTSW 1 183098575 missense probably damaging 0.99
R1835:Disp1 UTSW 1 183089000 missense probably damaging 1.00
R1954:Disp1 UTSW 1 183088543 missense probably damaging 0.99
R2025:Disp1 UTSW 1 183088203 missense probably damaging 1.00
R2136:Disp1 UTSW 1 183088378 missense probably damaging 1.00
R2150:Disp1 UTSW 1 183088372 missense probably damaging 1.00
R2207:Disp1 UTSW 1 183088342 missense possibly damaging 0.94
R2392:Disp1 UTSW 1 183087167 missense probably benign
R2831:Disp1 UTSW 1 183089319 small deletion probably benign
R3111:Disp1 UTSW 1 183087523 missense probably damaging 1.00
R3116:Disp1 UTSW 1 183088922 missense probably benign 0.01
R3160:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3161:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3716:Disp1 UTSW 1 183087751 missense probably damaging 1.00
R3914:Disp1 UTSW 1 183089102 missense probably benign 0.05
R4061:Disp1 UTSW 1 183087700 missense probably damaging 0.96
R4191:Disp1 UTSW 1 183089173 missense probably damaging 1.00
R4261:Disp1 UTSW 1 183089386 missense probably damaging 1.00
R4272:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4273:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4351:Disp1 UTSW 1 183099978 missense probably benign 0.01
R4672:Disp1 UTSW 1 183098651 critical splice acceptor site probably null
R4764:Disp1 UTSW 1 183088096 missense probably damaging 1.00
R4910:Disp1 UTSW 1 183135463 missense probably damaging 1.00
R5150:Disp1 UTSW 1 183089499 missense probably damaging 0.98
R5502:Disp1 UTSW 1 183087886 missense probably damaging 1.00
R5616:Disp1 UTSW 1 183088349 missense probably benign 0.30
R5813:Disp1 UTSW 1 183088410 missense probably damaging 1.00
R5820:Disp1 UTSW 1 183135587 missense probably benign 0.00
R6184:Disp1 UTSW 1 183086332 missense probably benign 0.00
R6228:Disp1 UTSW 1 183099025 missense possibly damaging 0.59
R6306:Disp1 UTSW 1 183087148 missense possibly damaging 0.93
R6505:Disp1 UTSW 1 183086512 missense probably benign 0.02
R6925:Disp1 UTSW 1 183086478 missense probably benign
R7016:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7045:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7046:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7047:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7114:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7123:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7124:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7125:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7161:Disp1 UTSW 1 183087625 missense possibly damaging 0.84
R7510:Disp1 UTSW 1 183088411 missense probably damaging 1.00
R7756:Disp1 UTSW 1 183089734 missense probably damaging 1.00
R7800:Disp1 UTSW 1 183098986 missense probably benign 0.00
R7929:Disp1 UTSW 1 183135539 missense probably benign
R8029:Disp1 UTSW 1 183089288 missense probably damaging 1.00
R8036:Disp1 UTSW 1 183089239 missense probably damaging 1.00
R8045:Disp1 UTSW 1 183089230 missense probably damaging 1.00
R8054:Disp1 UTSW 1 183088248 nonsense probably null
R8061:Disp1 UTSW 1 183087587 missense probably damaging 1.00
R8094:Disp1 UTSW 1 183087628 missense probably damaging 1.00
R8130:Disp1 UTSW 1 183135635 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTGACAGAAGTGTAAAATCCAGGC -3'
(R):5'- TCAGAGGCATCGCGGATTTTC -3'

Sequencing Primer
(F):5'- CCTGGGAGGCTGGGCTAG -3'
(R):5'- GTGCTGCCGTGCATAGTCATC -3'
Posted On2017-12-01