Incidental Mutation 'R5779:Cdk12'
ID501513
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98219074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 640 (S640R)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect probably benign
Transcript: ENSMUST00000003203
AA Change: S640R

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: S640R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107538
AA Change: S640R

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: S640R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107539
AA Change: S640R

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: S640R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145113
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7914:Cdk12 UTSW 11 98249827 missense unknown
R7960:Cdk12 UTSW 11 98240835 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCAGGTGTTCCATAGAGTTTT -3'
(R):5'- CATCCTGTTAAACTTACTTTGGTCT -3'

Sequencing Primer
(F):5'- ATCCCACTATAGATGGCTGTGAGC -3'
(R):5'- CTCTTTTTATATGGTTGTTGAGGTGG -3'
Posted On2017-12-01