Incidental Mutation 'R5795:Csf3'
ID 501524
Institutional Source Beutler Lab
Gene Symbol Csf3
Ensembl Gene ENSMUSG00000038067
Gene Name colony stimulating factor 3 (granulocyte)
Synonyms Csfg, MGI-IG, G-CSF
MMRRC Submission 043386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5795 (G1)
Quality Score 143
Status Not validated
Chromosome 11
Chromosomal Location 98701263-98703629 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 98702027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 72 (C72F)
Ref Sequence ENSEMBL: ENSMUSP00000037762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000038886] [ENSMUST00000100500] [ENSMUST00000138750]
AlphaFold P09920
Predicted Effect probably benign
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038886
AA Change: C72F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037762
Gene: ENSMUSG00000038067
AA Change: C72F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 54 N/A INTRINSIC
IL6 57 205 3.59e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100500
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125064
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes. The active protein is found extracellularly. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit chronic neutropenia, with severely reduced peripheral blood neutrophil levels, and reduced resistance to Listeria monocytogenes infection. Heterozygotes have intermediate neutrophil levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,309,489 V261A probably benign Het
Adipor1 C A 1: 134,424,903 N137K probably damaging Het
Ahnak A T 19: 9,012,382 K3677* probably null Het
Ankrd24 C A 10: 81,645,103 probably benign Het
Appl1 G T 14: 26,942,816 P420Q probably benign Het
Bmp8b C A 4: 123,121,968 F249L possibly damaging Het
Brat1 G T 5: 140,713,072 A275S probably benign Het
C5ar1 T C 7: 16,248,394 K234E possibly damaging Het
Ccs A G 19: 4,833,339 probably null Het
Chmp5 T G 4: 40,950,562 probably null Het
Chrna3 T A 9: 55,015,268 T419S probably benign Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Dbndd1 A G 8: 123,509,880 I83T probably damaging Het
Ercc6 A G 14: 32,526,352 K287E probably damaging Het
F5 C T 1: 164,152,009 T16I probably benign Het
Gif A G 19: 11,760,376 T384A probably damaging Het
Gm14085 T C 2: 122,517,994 M274T possibly damaging Het
Hephl1 C T 9: 15,069,760 G792E probably damaging Het
Hmmr T A 11: 40,721,906 D158V probably damaging Het
Hsd11b1 A G 1: 193,240,632 S76P possibly damaging Het
Ilvbl T C 10: 78,577,144 S167P probably benign Het
Irf7 G A 7: 141,265,116 P118L probably damaging Het
Lama1 A G 17: 67,796,727 N1981S probably benign Het
Lrp4 A G 2: 91,474,471 D224G probably benign Het
Mink1 T C 11: 70,607,790 Y594H possibly damaging Het
Minpp1 G A 19: 32,514,157 V412M probably damaging Het
Muc5b G A 7: 141,871,741 V4708M possibly damaging Het
Mycl G A 4: 122,996,622 E34K probably damaging Het
Oaf T A 9: 43,223,944 D179V probably damaging Het
Ogfod2 G A 5: 124,114,761 G278D probably damaging Het
Olfr1448 A G 19: 12,919,824 F162L possibly damaging Het
Olfr91 A G 17: 37,093,769 L35P probably damaging Het
Paf1 T G 7: 28,396,618 M250R probably damaging Het
Pcdh8 T C 14: 79,770,980 T48A possibly damaging Het
Pdzph1 A G 17: 58,885,867 V1096A possibly damaging Het
Polr3b A T 10: 84,628,252 E25D probably benign Het
Polr3b T C 10: 84,677,011 S586P probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc31a2 T C 4: 62,297,052 V112A probably damaging Het
Spire1 A T 18: 67,495,195 S412T probably benign Het
Tanc1 A G 2: 59,807,582 T876A possibly damaging Het
Tango6 T A 8: 106,718,077 L538H probably damaging Het
Tas2r125 G A 6: 132,909,658 G3D probably damaging Het
Tbc1d32 A T 10: 56,215,062 M125K possibly damaging Het
Traf5 T C 1: 191,999,846 S345G probably benign Het
Ush2a A T 1: 188,443,397 I1231F probably benign Het
Vmn2r104 G T 17: 20,030,110 T633N probably benign Het
Vmn2r104 A G 17: 20,030,282 S576P possibly damaging Het
Vmn2r105 A T 17: 20,228,736 C60S probably benign Het
Zfp316 A T 5: 143,262,839 D217E unknown Het
Zfp456 A T 13: 67,366,920 D222E probably benign Het
Other mutations in Csf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Csf3 APN 11 98702477 missense probably damaging 1.00
R1210:Csf3 UTSW 11 98702477 missense probably damaging 1.00
R1769:Csf3 UTSW 11 98702420 missense probably damaging 1.00
R2041:Csf3 UTSW 11 98701657 missense possibly damaging 0.49
R5112:Csf3 UTSW 11 98702923 missense probably damaging 1.00
R6825:Csf3 UTSW 11 98702447 missense probably damaging 1.00
R7985:Csf3 UTSW 11 98702447 missense probably damaging 1.00
R8473:Csf3 UTSW 11 98702102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACCCTCAGAATACTGAC -3'
(R):5'- GGGATGCTTGCTCTCTTCAG -3'

Sequencing Primer
(F):5'- CTCAGAATACTGACAGAAACATTGAG -3'
(R):5'- TCTCTTCAGGAGCCCAAATAGTAGG -3'
Posted On 2017-12-01