Incidental Mutation 'R5796:Cd33'
ID501525
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene NameCD33 antigen
SynonymsSiglec-3, gp67
MMRRC Submission 043387-MU
Accession Numbers

Genbank: NM_001111058.1, NM_021293.3; Ensembl: ENSMUST00000004728, ENSMUST00000039861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5796 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43524216-43544428 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 43533056 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
Predicted Effect probably null
Transcript: ENSMUST00000004728
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000004728
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039861
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205687
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206977
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,421,428 T9A possibly damaging Het
1700125H20Rik A G 11: 85,173,275 T81A probably null Het
Abcd3 G A 3: 121,784,498 R160W probably damaging Het
Ap3d1 G T 10: 80,714,037 T758K possibly damaging Het
Ate1 T C 7: 130,467,268 Y423C probably damaging Het
Bsn C T 9: 108,126,024 G394D probably damaging Het
Cacna1d T C 14: 30,066,116 D1599G probably damaging Het
Col12a1 T C 9: 79,703,829 N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Cts3 A T 13: 61,568,703 Y40N probably damaging Het
Cyfip2 T C 11: 46,198,996 N1197D probably benign Het
Dclre1b G A 3: 103,807,457 Q77* probably null Het
Dsc3 T A 18: 19,971,501 M590L probably benign Het
Efcab14 A T 4: 115,746,583 I153F probably damaging Het
Fbxo42 T C 4: 141,199,789 V460A probably benign Het
Fgl1 T G 8: 41,199,759 probably benign Het
Gbf1 T C 19: 46,284,343 S1697P probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13083 A G 4: 143,615,208 N69S probably benign Het
Gm15056 C A 8: 20,901,982 probably benign Het
Gm17409 T A 2: 58,471,022 probably benign Het
Gm20730 A G 6: 43,081,530 L116P probably damaging Het
Gm4450 A T 3: 98,446,852 D110E probably benign Het
Grb2 T G 11: 115,645,872 H184P probably benign Het
Hepacam2 G C 6: 3,466,200 probably null Het
Igkv4-55 T A 6: 69,607,448 K60M possibly damaging Het
Itfg1 T A 8: 85,718,893 H603L probably damaging Het
Katna1 C A 10: 7,760,811 D366E probably damaging Het
Klk1b26 A G 7: 44,016,328 Y188C probably damaging Het
Ldhd T C 8: 111,627,090 T464A probably benign Het
Muc5b T C 7: 141,857,396 S1360P unknown Het
Nckipsd T G 9: 108,811,614 V116G probably benign Het
Nhsl1 C T 10: 18,524,250 S374L probably benign Het
Oxt G A 2: 130,576,613 G48D probably damaging Het
Ptprk C T 10: 28,383,575 T337I probably damaging Het
Rad54b A T 4: 11,615,446 D818V probably benign Het
Rbpjl T C 2: 164,410,248 probably benign Het
Recql5 T A 11: 115,927,865 probably benign Het
Robo4 A T 9: 37,411,674 D830V probably benign Het
Rps6kb1 C T 11: 86,511,851 G339S probably benign Het
Rtel1 G A 2: 181,340,506 E350K probably benign Het
Rtn3 A G 19: 7,457,467 S368P possibly damaging Het
Smad5 A G 13: 56,723,832 H80R probably damaging Het
Sppl2c T A 11: 104,187,793 M473K probably benign Het
Tbrg1 A G 9: 37,652,575 probably benign Het
Tcf7 A G 11: 52,261,527 I65T probably benign Het
Tgm2 T C 2: 158,118,904 D618G probably benign Het
Tuba3b C T 6: 145,619,682 T292I probably damaging Het
Vmn1r63 G A 7: 5,803,141 S164L probably benign Het
Zfp382 A G 7: 30,133,349 K142E probably damaging Het
Zmym3 G A X: 101,415,800 P308L probably benign Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43529558 intron probably benign
IGL01025:Cd33 APN 7 43532905 missense probably damaging 1.00
IGL01593:Cd33 APN 7 43530281 missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43528850 utr 3 prime probably benign
IGL02519:Cd33 APN 7 43528729 utr 3 prime probably benign
IGL02626:Cd33 APN 7 43530312 splice site probably benign
1mM(1):Cd33 UTSW 7 43528793 utr 3 prime probably benign
R0751:Cd33 UTSW 7 43532121 missense probably damaging 1.00
R1513:Cd33 UTSW 7 43532194 missense probably damaging 1.00
R1542:Cd33 UTSW 7 43532106 missense probably damaging 1.00
R1752:Cd33 UTSW 7 43532298 missense probably benign 0.24
R1928:Cd33 UTSW 7 43529879 missense probably benign 0.41
R2045:Cd33 UTSW 7 43529892 missense probably benign 0.00
R2127:Cd33 UTSW 7 43530275 missense possibly damaging 0.72
R3433:Cd33 UTSW 7 43529907 missense probably benign 0.00
R4760:Cd33 UTSW 7 43529495 missense probably benign
R4810:Cd33 UTSW 7 43532710 missense probably damaging 0.99
R5387:Cd33 UTSW 7 43532053 nonsense probably null
R5611:Cd33 UTSW 7 43532118 missense probably damaging 0.97
R8021:Cd33 UTSW 7 43528838 missense unknown
R8193:Cd33 UTSW 7 43532272 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTCACAGGTCCTAAAGTGAG -3'
(R):5'- GGTCAATTACTCTCTGCCTGAC -3'

Sequencing Primer
(F):5'- CACAGGTCCTAAAGTGAGCTTAATG -3'
(R):5'- CTCTGCCTGACTTTATTACTGGGG -3'
Posted On2017-12-01