Incidental Mutation 'R5796:Cd33'
ID 501525
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene Name CD33 molecule
Synonyms Siglec-3, gp67
MMRRC Submission 043387-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5796 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43176823-43186679 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 43182480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
AlphaFold Q63994
Predicted Effect probably null
Transcript: ENSMUST00000004728
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000004728
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039861
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205687
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206977
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 93% (51/55)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,215,077 (GRCm39) T9A possibly damaging Het
Abcd3 G A 3: 121,578,147 (GRCm39) R160W probably damaging Het
Ap3d1 G T 10: 80,549,871 (GRCm39) T758K possibly damaging Het
Ate1 T C 7: 130,068,998 (GRCm39) Y423C probably damaging Het
Bsn C T 9: 108,003,223 (GRCm39) G394D probably damaging Het
Cacna1d T C 14: 29,788,073 (GRCm39) D1599G probably damaging Het
Chct1 A G 11: 85,064,101 (GRCm39) T81A probably null Het
Col12a1 T C 9: 79,611,111 (GRCm39) N154D possibly damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 140,769,118 (GRCm39) probably null Het
Cts3 A T 13: 61,716,517 (GRCm39) Y40N probably damaging Het
Cyfip2 T C 11: 46,089,823 (GRCm39) N1197D probably benign Het
Dclre1b G A 3: 103,714,773 (GRCm39) Q77* probably null Het
Dsc3 T A 18: 20,104,558 (GRCm39) M590L probably benign Het
Efcab14 A T 4: 115,603,780 (GRCm39) I153F probably damaging Het
Fbxo42 T C 4: 140,927,100 (GRCm39) V460A probably benign Het
Fgl1 T G 8: 41,652,796 (GRCm39) probably benign Het
Gbf1 T C 19: 46,272,782 (GRCm39) S1697P probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm15056 C A 8: 21,391,998 (GRCm39) probably benign Het
Gm17409 T A 2: 58,361,034 (GRCm39) probably benign Het
Gm20730 A G 6: 43,058,464 (GRCm39) L116P probably damaging Het
Grb2 T G 11: 115,536,698 (GRCm39) H184P probably benign Het
Hepacam2 G C 6: 3,466,200 (GRCm39) probably null Het
Hsd3b9 A T 3: 98,354,168 (GRCm39) D110E probably benign Het
Igkv4-55 T A 6: 69,584,432 (GRCm39) K60M possibly damaging Het
Itfg1 T A 8: 86,445,522 (GRCm39) H603L probably damaging Het
Katna1 C A 10: 7,636,575 (GRCm39) D366E probably damaging Het
Klk1b26 A G 7: 43,665,752 (GRCm39) Y188C probably damaging Het
Ldhd T C 8: 112,353,722 (GRCm39) T464A probably benign Het
Muc5b T C 7: 141,411,133 (GRCm39) S1360P unknown Het
Nckipsd T G 9: 108,688,813 (GRCm39) V116G probably benign Het
Nhsl1 C T 10: 18,399,998 (GRCm39) S374L probably benign Het
Oxt G A 2: 130,418,533 (GRCm39) G48D probably damaging Het
Pramel21 A G 4: 143,341,778 (GRCm39) N69S probably benign Het
Ptprk C T 10: 28,259,571 (GRCm39) T337I probably damaging Het
Rad54b A T 4: 11,615,446 (GRCm39) D818V probably benign Het
Rbpjl T C 2: 164,252,168 (GRCm39) probably benign Het
Recql5 T A 11: 115,818,691 (GRCm39) probably benign Het
Robo4 A T 9: 37,322,970 (GRCm39) D830V probably benign Het
Rps6kb1 C T 11: 86,402,677 (GRCm39) G339S probably benign Het
Rtel1 G A 2: 180,982,299 (GRCm39) E350K probably benign Het
Rtn3 A G 19: 7,434,832 (GRCm39) S368P possibly damaging Het
Smad5 A G 13: 56,871,645 (GRCm39) H80R probably damaging Het
Sppl2c T A 11: 104,078,619 (GRCm39) M473K probably benign Het
Tbrg1 A G 9: 37,563,871 (GRCm39) probably benign Het
Tcf7 A G 11: 52,152,354 (GRCm39) I65T probably benign Het
Tgm2 T C 2: 157,960,824 (GRCm39) D618G probably benign Het
Tuba3b C T 6: 145,565,408 (GRCm39) T292I probably damaging Het
Vmn1r63 G A 7: 5,806,140 (GRCm39) S164L probably benign Het
Zfp382 A G 7: 29,832,774 (GRCm39) K142E probably damaging Het
Zmym3 G A X: 100,459,406 (GRCm39) P308L probably benign Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43,178,982 (GRCm39) intron probably benign
IGL01025:Cd33 APN 7 43,182,329 (GRCm39) missense probably damaging 1.00
IGL01593:Cd33 APN 7 43,179,705 (GRCm39) missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43,178,274 (GRCm39) utr 3 prime probably benign
IGL02519:Cd33 APN 7 43,178,153 (GRCm39) utr 3 prime probably benign
IGL02626:Cd33 APN 7 43,179,736 (GRCm39) splice site probably benign
1mM(1):Cd33 UTSW 7 43,178,217 (GRCm39) utr 3 prime probably benign
R0751:Cd33 UTSW 7 43,181,545 (GRCm39) missense probably damaging 1.00
R1513:Cd33 UTSW 7 43,181,618 (GRCm39) missense probably damaging 1.00
R1542:Cd33 UTSW 7 43,181,530 (GRCm39) missense probably damaging 1.00
R1752:Cd33 UTSW 7 43,181,722 (GRCm39) missense probably benign 0.24
R1928:Cd33 UTSW 7 43,179,303 (GRCm39) missense probably benign 0.41
R2045:Cd33 UTSW 7 43,179,316 (GRCm39) missense probably benign 0.00
R2127:Cd33 UTSW 7 43,179,699 (GRCm39) missense possibly damaging 0.72
R3433:Cd33 UTSW 7 43,179,331 (GRCm39) missense probably benign 0.00
R4760:Cd33 UTSW 7 43,178,919 (GRCm39) missense probably benign
R4810:Cd33 UTSW 7 43,182,134 (GRCm39) missense probably damaging 0.99
R5387:Cd33 UTSW 7 43,181,477 (GRCm39) nonsense probably null
R5611:Cd33 UTSW 7 43,181,542 (GRCm39) missense probably damaging 0.97
R8021:Cd33 UTSW 7 43,178,262 (GRCm39) missense unknown
R8193:Cd33 UTSW 7 43,181,696 (GRCm39) missense possibly damaging 0.96
R8993:Cd33 UTSW 7 43,182,871 (GRCm39) unclassified probably benign
R9495:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9514:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9590:Cd33 UTSW 7 43,179,637 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGGTCCTAAAGTGAG -3'
(R):5'- GGTCAATTACTCTCTGCCTGAC -3'

Sequencing Primer
(F):5'- CACAGGTCCTAAAGTGAGCTTAATG -3'
(R):5'- CTCTGCCTGACTTTATTACTGGGG -3'
Posted On 2017-12-01