Incidental Mutation 'R5797:Acsf2'
ID501528
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Nameacyl-CoA synthetase family member 2
Synonyms
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94557102-94601871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94571679 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 170 (V170A)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040418] [ENSMUST00000103164]
AlphaFold Q8VCW8
Predicted Effect probably benign
Transcript: ENSMUST00000040418
SMART Domains Protein: ENSMUSP00000047844
Gene: ENSMUSG00000039084

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 21 54 1.7e-7 SMART
LRR_TYP 73 96 9.58e-3 SMART
LRR_TYP 97 120 1.45e-2 SMART
LRR_TYP 121 144 1.69e-3 SMART
LRR_TYP 145 168 6.42e-4 SMART
LRR 170 192 2.2e1 SMART
LRR 193 216 2.14e1 SMART
LRR_TYP 217 240 4.17e-3 SMART
LRR 245 265 2.27e2 SMART
LRR 266 289 3.36e1 SMART
LRRCT 299 346 1.1e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103164
AA Change: V170A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: V170A

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155122
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Vmn2r12 A T 5: 109,085,870 C825* probably null Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
Citrus UTSW 11 94571650 missense probably benign 0.11
limonene UTSW 11 94562888 missense probably damaging 0.99
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R3610:Acsf2 UTSW 11 94561346 missense probably benign 0.00
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5872:Acsf2 UTSW 11 94573149 missense probably benign 0.16
R6350:Acsf2 UTSW 11 94558330 missense probably benign 0.12
R6903:Acsf2 UTSW 11 94559591 missense probably benign 0.03
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7336:Acsf2 UTSW 11 94571650 missense probably benign 0.11
R7531:Acsf2 UTSW 11 94573231 splice site probably null
R8026:Acsf2 UTSW 11 94562888 missense probably damaging 0.99
R8231:Acsf2 UTSW 11 94561362 missense probably benign 0.01
R8355:Acsf2 UTSW 11 94570624 missense probably benign 0.00
R8486:Acsf2 UTSW 11 94569960 missense probably damaging 0.98
R8525:Acsf2 UTSW 11 94572620 missense probably benign 0.21
R8956:Acsf2 UTSW 11 94570385 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGCTCCACCTTTGTAGGAG -3'
(R):5'- GGTATACATGACTGCATTAGAGGC -3'

Sequencing Primer
(F):5'- CCACCTTTGTAGGAGGTAAGAGTC -3'
(R):5'- TGCATTAGAGGCAGTGGTG -3'
Posted On2017-12-01