Incidental Mutation 'R5784:Hdhd2'
ID501542
Institutional Source Beutler Lab
Gene Symbol Hdhd2
Ensembl Gene ENSMUSG00000025421
Gene Namehaloacid dehalogenase-like hydrolase domain containing 2
Synonyms0610039H12Rik, 3110052N05Rik
MMRRC Submission 043381-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5784 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76930126-76972902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76967145 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 205 (D205V)
Ref Sequence ENSEMBL: ENSMUSP00000114212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026485] [ENSMUST00000097522] [ENSMUST00000142456] [ENSMUST00000145634] [ENSMUST00000148955] [ENSMUST00000150990]
PDB Structure
Crystal Structure of Protein from Mouse Mm.236127 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026485
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026485
Gene: ENSMUSG00000025421
AA Change: D205V

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.1e-21 PFAM
Pfam:HAD_2 167 223 1e-7 PFAM
Pfam:Hydrolase_like 176 251 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097522
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095129
Gene: ENSMUSG00000025421
AA Change: D205V

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142456
SMART Domains Protein: ENSMUSP00000118504
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Yos1 5 66 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145634
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421
AA Change: D205V

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148955
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421
AA Change: D205V

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150990
AA Change: D205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421
AA Change: D205V

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a transposon insertion results in complete embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,607 R292G possibly damaging Het
4932416K20Rik T A 8: 104,797,629 noncoding transcript Het
Aox3 A G 1: 58,153,499 D544G probably benign Het
Atg2a C A 19: 6,261,505 A1830D probably damaging Het
Casp1 T C 9: 5,299,337 I22T probably damaging Het
Ccdc141 A C 2: 77,029,327 L990W probably damaging Het
Cnbd2 A G 2: 156,338,657 T125A probably damaging Het
Cnep1r1 T A 8: 88,130,726 probably benign Het
Dhx38 G T 8: 109,559,613 Y348* probably null Het
Dnah7c A T 1: 46,524,068 I593L possibly damaging Het
Dpep3 T C 8: 105,978,743 D125G probably benign Het
Epb41l4b A C 4: 57,086,003 S191A probably damaging Het
Etl4 A G 2: 20,806,205 Y1033C possibly damaging Het
Fam193a T C 5: 34,466,223 L32P probably damaging Het
Gm8332 T A 12: 88,249,755 N116Y probably damaging Het
Grin2c T C 11: 115,258,295 E159G possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Helz T A 11: 107,670,481 N774K unknown Het
Idh3b A G 2: 130,279,671 V71A probably damaging Het
Lars T C 18: 42,219,899 M818V probably benign Het
Ltbp2 A G 12: 84,868,739 V162A probably damaging Het
Ltk G A 2: 119,754,359 Q136* probably null Het
Mafb A T 2: 160,366,541 C46S probably damaging Het
Map1s T C 8: 70,914,358 S636P probably damaging Het
Map3k13 A G 16: 21,898,641 K209E possibly damaging Het
Mppe1 T C 18: 67,228,027 N220D probably benign Het
Mydgf T C 17: 56,178,254 probably benign Het
Myh6 T C 14: 54,953,064 K999E possibly damaging Het
Nemp1 T A 10: 127,677,198 V34D possibly damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Olfr1497 A T 19: 13,795,346 H88Q probably benign Het
Olfr248 G A 1: 174,391,399 C110Y probably damaging Het
Olfr309 T C 7: 86,306,535 N193D probably damaging Het
Papln A G 12: 83,781,980 N820S probably benign Het
Pcdh10 T G 3: 45,380,640 F463C probably damaging Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Radil G T 5: 142,487,513 H804Q possibly damaging Het
Rbfox1 A T 16: 7,224,339 D39V probably damaging Het
Rims2 T G 15: 39,535,987 probably null Het
Rnf121 A G 7: 102,035,376 F110S probably benign Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc2a3 A T 6: 122,735,417 probably null Het
Traf2 A T 2: 25,539,037 V6E probably benign Het
Trim43c A T 9: 88,847,643 N379I probably benign Het
Ubr4 C G 4: 139,425,218 C1973W probably damaging Het
Unc13a G T 8: 71,655,666 D514E possibly damaging Het
Wdr27 T A 17: 14,926,233 T167S probably damaging Het
Zfp174 A T 16: 3,854,574 E329V probably benign Het
Zfp422 A T 6: 116,626,810 I76N probably damaging Het
Other mutations in Hdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Hdhd2 APN 18 76965273 splice site probably null
IGL01102:Hdhd2 APN 18 76956911 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0717:Hdhd2 UTSW 18 76951204 missense possibly damaging 0.94
R1958:Hdhd2 UTSW 18 76965145 missense probably benign
R2060:Hdhd2 UTSW 18 76965042 splice site probably null
R2266:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2268:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2269:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2873:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R3788:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R3789:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R7403:Hdhd2 UTSW 18 76955040 missense probably benign 0.00
R7406:Hdhd2 UTSW 18 76944115 missense probably benign 0.01
R7644:Hdhd2 UTSW 18 76944175 missense possibly damaging 0.79
R7849:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
R7932:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCTCAAGGTTTACAGAGATG -3'
(R):5'- TGCTGGCAACTCTGGGTTTC -3'

Sequencing Primer
(F):5'- CAAGGTTTACAGAGATGCTTTAACTC -3'
(R):5'- CAGTGTTTACAGGCCAGACTG -3'
Posted On2017-12-01