Mutagenetix > Incidental Mutation

Incidental Mutation 'R5807:Eif2ak4'

501554

Institutional Source

Beutler Lab

Gene Symbol

Eif2ak4

Ensembl Gene

ENSMUSG00000005102

Gene Name

eukaryotic translation initiation factor 2 alpha kinase 4

Synonyms

GCN2

MMRRC Submission

043393-MU

Accession Numbers

MGI: 1353427

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5807 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

118388618-118475234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 118388851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 48 (R48L)

Ref Sequence

ENSEMBL: ENSMUSP00000106501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005233
AA Change: R48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: R48L

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	4.6e-27	PFAM
Pfam:Pkinase_Tyr	326	535	5.5e-18	PFAM
Pfam:Pkinase	589	663	1.7e-11	PFAM
Pfam:Pkinase_Tyr	589	663	1.2e-5	PFAM
low complexity region	728	738	N/A	INTRINSIC
Pfam:Pkinase	781	1000	2.6e-38	PFAM
Pfam:Pkinase_Tyr	786	998	1.8e-18	PFAM
Pfam:tRNA-synt_His	1054	1380	5.7e-18	PFAM
Pfam:HGTP_anticodon2	1392	1647	5.8e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102527

SMART Domains

Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102

Domain	Start	End	E-Value	Type
coiled coil region	34	93	N/A	INTRINSIC
Pfam:Pkinase	211	426	1.6e-22	PFAM
Pfam:Pkinase_Tyr	215	423	6.8e-18	PFAM
Pfam:Pkinase_Tyr	477	551	1.2e-5	PFAM
Pfam:Pkinase	477	552	3.9e-11	PFAM
low complexity region	616	626	N/A	INTRINSIC
Pfam:Pkinase	647	888	9.4e-42	PFAM
Pfam:Pkinase_Tyr	672	886	1.4e-19	PFAM
Pfam:tRNA-synt_His	941	1268	4.8e-19	PFAM
Pfam:HGTP_anticodon2	1280	1535	1e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110872

SMART Domains

Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102

Domain	Start	End	E-Value	Type
coiled coil region	25	84	N/A	INTRINSIC
Pfam:Pkinase	202	417	3.8e-22	PFAM
Pfam:Pkinase_Tyr	206	414	1.6e-17	PFAM
Pfam:Pkinase_Tyr	468	542	2.8e-5	PFAM
Pfam:Pkinase	468	543	9.1e-11	PFAM
low complexity region	607	617	N/A	INTRINSIC
Pfam:Pkinase	638	879	2.2e-41	PFAM
Pfam:Pkinase_Tyr	663	877	3.3e-19	PFAM
Pfam:tRNA-synt_His	932	1259	1.1e-18	PFAM
Pfam:HGTP_anticodon2	1271	1526	2.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110874

SMART Domains

Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102

Domain	Start	End	E-Value	Type
Pfam:RWD	8	56	6.4e-8	PFAM
coiled coil region	68	127	N/A	INTRINSIC
Pfam:Pkinase	245	460	1.1e-22	PFAM
Pfam:Pkinase_Tyr	247	457	4.2e-18	PFAM
Pfam:Pkinase_Tyr	511	585	7.8e-6	PFAM
Pfam:Pkinase	511	586	2.5e-11	PFAM
low complexity region	650	660	N/A	INTRINSIC
Pfam:Pkinase	681	922	6.2e-42	PFAM
Pfam:Pkinase_Tyr	706	920	9.3e-20	PFAM
Pfam:tRNA-synt_His	975	1302	3.8e-19	PFAM
Pfam:HGTP_anticodon2	1314	1569	5.4e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110877
AA Change: R48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: R48L

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	2.6e-23	PFAM
Pfam:Pkinase_Tyr	327	535	1.1e-18	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,303,492	L943P	probably damaging	Het
Abcg5	C	A	17: 84,672,291	V214F	probably damaging	Het
Ang	T	A	14: 51,101,429		probably benign	Het
Arfgef3	A	G	10: 18,647,798		probably null	Het
Arhgef4	A	G	1: 34,807,615		probably benign	Het
Atp11b	T	C	3: 35,812,279	I409T	probably damaging	Het
Atp5b	G	A	10: 128,088,562		probably benign	Het
Atp9a	G	A	2: 168,653,534	A660V	probably damaging	Het
Avpr1a	A	G	10: 122,449,471	T223A	probably benign	Het
Bmp2k	T	C	5: 97,063,494	M507T	unknown	Het
Cep295	A	G	9: 15,332,532	S287P	probably damaging	Het
Chrna7	T	A	7: 63,148,601	D111V	probably damaging	Het
Cnr2	A	G	4: 135,917,436	D275G	probably benign	Het
Col28a1	T	A	6: 8,158,144	M305L	probably benign	Het
Cpb1	T	A	3: 20,263,742	D206V	probably damaging	Het
Cyp2c50	T	C	19: 40,113,500	L453S	probably damaging	Het
Ddx52	T	G	11: 83,949,682	S284A	probably benign	Het
Efcab1	A	T	16: 14,916,972	I69F	probably benign	Het
Esrrb	A	G	12: 86,514,401	E303G	possibly damaging	Het
Fbxo21	A	G	5: 117,976,868	E23G	probably benign	Het
Fcamr	T	C	1: 130,811,526	S188P	probably damaging	Het
Fer1l6	C	A	15: 58,590,550	S818*	probably null	Het
Fn1	T	C	1: 71,648,059	D213G	probably damaging	Het
Gcg	A	G	2: 62,475,725	I176T	possibly damaging	Het
Glis1	T	A	4: 107,568,082	S109T	probably benign	Het
Gm266	T	C	12: 111,485,739	D11G	probably benign	Het
Gm5070	C	A	3: 95,410,654		noncoding transcript	Het
Gm8444	T	C	15: 81,843,453		probably benign	Het
Gm8989	T	A	7: 106,330,223		noncoding transcript	Het
Golga4	A	G	9: 118,527,130	T117A	probably damaging	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Herc2	T	A	7: 56,230,919	F4766L	probably damaging	Het
Inhbc	C	A	10: 127,357,542	E202*	probably null	Het
Kcnu1	C	T	8: 25,849,714	T20I	possibly damaging	Het
Klhdc3	T	C	17: 46,677,465	D161G	probably damaging	Het
Krt84	T	A	15: 101,530,212	K280M	probably damaging	Het
Krtap9-5	T	A	11: 99,949,069	C199S	unknown	Het
Mrgprb3	A	G	7: 48,643,362	V147A	probably benign	Het
Ndufs6	A	T	13: 73,327,434	F48L	probably damaging	Het
Obscn	T	C	11: 59,079,650	S2586G	probably damaging	Het
Olfr148	A	G	9: 39,614,463	R299G	probably benign	Het
Olfr156	C	A	4: 43,820,912	V150L	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Osbpl6	A	G	2: 76,584,513	D416G	probably damaging	Het
Pdilt	A	G	7: 119,500,543		probably benign	Het
Phf12	C	A	11: 78,022,426	D401E	probably benign	Het
Pla2r1	C	T	2: 60,428,721	V1108M	possibly damaging	Het
Prim2	A	G	1: 33,480,406		probably benign	Het
Ptpn6	T	C	6: 124,724,984	H406R	probably benign	Het
Qpctl	G	T	7: 19,143,207	H329N	probably damaging	Het
Ripk3	T	A	14: 55,785,298	N390Y	probably damaging	Het
Rnase1	A	G	14: 51,145,450	V149A	probably benign	Het
Rtn3	T	A	19: 7,456,827	D581V	probably damaging	Het
Slamf1	A	G	1: 171,775,062	Y119C	probably damaging	Het
Slc25a34	A	G	4: 141,623,662	M12T	probably benign	Het
Tmem38a	A	G	8: 72,580,100	Y141C	probably damaging	Het
Tnr	C	T	1: 159,886,930	T793I	possibly damaging	Het
Tns3	T	C	11: 8,493,211	D384G	probably damaging	Het
Vmn2r116	T	A	17: 23,387,307	Y398N	probably damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het

Other mutations in Eif2ak4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Eif2ak4	APN	2	118464055	missense	probably damaging	1.00
IGL00806:Eif2ak4	APN	2	118441166	missense	probably benign	0.08
IGL01343:Eif2ak4	APN	2	118422089	missense	probably benign	0.00
IGL01796:Eif2ak4	APN	2	118446304	missense	probably benign	0.10
IGL02263:Eif2ak4	APN	2	118461778	missense	probably benign	0.00
IGL02391:Eif2ak4	APN	2	118420791	missense	probably benign	0.19
IGL02516:Eif2ak4	APN	2	118436254	missense	probably damaging	1.00
IGL02603:Eif2ak4	APN	2	118450326	missense	probably damaging	1.00
IGL02731:Eif2ak4	APN	2	118388814	missense	probably benign
IGL02928:Eif2ak4	APN	2	118472687	critical splice donor site	probably null
IGL02947:Eif2ak4	APN	2	118431033	missense	probably benign	0.00
IGL03191:Eif2ak4	APN	2	118422212	missense	probably damaging	1.00
IGL03202:Eif2ak4	APN	2	118400620	missense	probably damaging	1.00
IGL03235:Eif2ak4	APN	2	118443140	missense	probably damaging	1.00
IGL03375:Eif2ak4	APN	2	118422318	missense	probably benign	0.08
absurdum	UTSW	2	118420810	nonsense	probably null
Ad	UTSW	2	118436241	missense	probably damaging	1.00
atchoum	UTSW	2	118400653	splice site	probably benign
reductio	UTSW	2	118436158	splice site	probably null
PIT4520001:Eif2ak4	UTSW	2	118462327	missense	probably damaging	1.00
R0023:Eif2ak4	UTSW	2	118462721	missense	probably damaging	1.00
R0358:Eif2ak4	UTSW	2	118463929	splice site	probably null
R0482:Eif2ak4	UTSW	2	118462347	missense	probably damaging	1.00
R0505:Eif2ak4	UTSW	2	118431036	missense	probably benign	0.01
R0523:Eif2ak4	UTSW	2	118442096	critical splice donor site	probably null
R0578:Eif2ak4	UTSW	2	118474991	splice site	probably benign
R0615:Eif2ak4	UTSW	2	118436185	missense	probably damaging	1.00
R1300:Eif2ak4	UTSW	2	118463983	missense	possibly damaging	0.79
R1531:Eif2ak4	UTSW	2	118443210	missense	probably damaging	1.00
R1777:Eif2ak4	UTSW	2	118430839	missense	probably damaging	0.98
R1866:Eif2ak4	UTSW	2	118472661	missense	probably damaging	1.00
R1932:Eif2ak4	UTSW	2	118448486	missense	probably damaging	1.00
R1977:Eif2ak4	UTSW	2	118461757	nonsense	probably null
R2011:Eif2ak4	UTSW	2	118430947	missense	probably damaging	1.00
R2046:Eif2ak4	UTSW	2	118451408	splice site	probably benign
R2122:Eif2ak4	UTSW	2	118455793	missense	probably damaging	1.00
R2125:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2126:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2193:Eif2ak4	UTSW	2	118422266	missense	probably benign	0.12
R2259:Eif2ak4	UTSW	2	118455783	missense	probably damaging	0.97
R2513:Eif2ak4	UTSW	2	118426583	missense	probably damaging	1.00
R3798:Eif2ak4	UTSW	2	118474083	missense	probably damaging	1.00
R3898:Eif2ak4	UTSW	2	118430923	missense	probably damaging	1.00
R3900:Eif2ak4	UTSW	2	118475029	missense	probably damaging	1.00
R4375:Eif2ak4	UTSW	2	118427924	missense	probably damaging	1.00
R4423:Eif2ak4	UTSW	2	118439066	missense	probably benign	0.01
R4589:Eif2ak4	UTSW	2	118417338	missense	probably damaging	1.00
R4734:Eif2ak4	UTSW	2	118422087	missense	probably damaging	1.00
R5173:Eif2ak4	UTSW	2	118408360	missense	probably damaging	1.00
R5367:Eif2ak4	UTSW	2	118436158	splice site	probably null
R5471:Eif2ak4	UTSW	2	118474132	missense	probably benign	0.02
R5528:Eif2ak4	UTSW	2	118427938	missense	probably damaging	1.00
R5634:Eif2ak4	UTSW	2	118462311	missense	probably damaging	1.00
R5726:Eif2ak4	UTSW	2	118443132	missense	probably damaging	1.00
R5756:Eif2ak4	UTSW	2	118462740	missense	possibly damaging	0.95
R5779:Eif2ak4	UTSW	2	118412963	missense	possibly damaging	0.85
R6045:Eif2ak4	UTSW	2	118388815	nonsense	probably null
R6187:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R6193:Eif2ak4	UTSW	2	118400600	start gained	probably benign
R6468:Eif2ak4	UTSW	2	118436241	missense	probably damaging	1.00
R6555:Eif2ak4	UTSW	2	118427869	missense	probably damaging	0.96
R6616:Eif2ak4	UTSW	2	118454845	nonsense	probably null
R6737:Eif2ak4	UTSW	2	118462268	frame shift	probably null
R6956:Eif2ak4	UTSW	2	118422267	missense	probably damaging	0.96
R7075:Eif2ak4	UTSW	2	118420810	nonsense	probably null
R7109:Eif2ak4	UTSW	2	118405051	missense	probably damaging	1.00
R7228:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R7441:Eif2ak4	UTSW	2	118471896	missense	probably benign	0.01
R7555:Eif2ak4	UTSW	2	118417283	missense	possibly damaging	0.64
R7567:Eif2ak4	UTSW	2	118450314	missense	probably benign
R8004:Eif2ak4	UTSW	2	118417294	missense	possibly damaging	0.64
R8063:Eif2ak4	UTSW	2	118410901	missense	possibly damaging	0.94
R8092:Eif2ak4	UTSW	2	118442032	missense	probably damaging	1.00
R8195:Eif2ak4	UTSW	2	118450338	missense	possibly damaging	0.50
R8306:Eif2ak4	UTSW	2	118457175	missense	possibly damaging	0.68
R8470:Eif2ak4	UTSW	2	118462726	missense	probably damaging	0.98
R8671:Eif2ak4	UTSW	2	118422186	missense	possibly damaging	0.88
R8693:Eif2ak4	UTSW	2	118432237	missense	probably damaging	0.98
R8714:Eif2ak4	UTSW	2	118462284	missense	possibly damaging	0.89
R8744:Eif2ak4	UTSW	2	118430993	nonsense	probably null
R8813:Eif2ak4	UTSW	2	118448325	missense	probably damaging	1.00
R8917:Eif2ak4	UTSW	2	118457136	missense	probably damaging	1.00
R8924:Eif2ak4	UTSW	2	118428032	missense	probably damaging	1.00
R9177:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9189:Eif2ak4	UTSW	2	118427912	missense	probably damaging	1.00
R9231:Eif2ak4	UTSW	2	118441181	missense	probably benign	0.00
R9268:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9321:Eif2ak4	UTSW	2	118462317	missense	possibly damaging	0.93
R9512:Eif2ak4	UTSW	2	118462715	missense	probably damaging	1.00
R9569:Eif2ak4	UTSW	2	118420835	missense	probably benign	0.00
R9658:Eif2ak4	UTSW	2	118439030	missense	probably damaging	1.00
R9748:Eif2ak4	UTSW	2	118417249	missense	probably benign	0.01
R9757:Eif2ak4	UTSW	2	118438917	missense	probably benign	0.02
R9766:Eif2ak4	UTSW	2	118430832	nonsense	probably null
X0061:Eif2ak4	UTSW	2	118468176	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCTGTCATCAGCTCGAG -3'
(R):5'- AGAGAATTCAGGCCAGGTGC -3'

Sequencing Primer
(F):5'- GAATCACCGCTACCTCGCCTAG -3'
(R):5'- CTGCCTTCTCAAGACCAGTGG -3'

Posted On

2017-12-01