Mutagenetix > Incidental Mutation

Incidental Mutation 'R5802:Ptpru'

501563

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

043391-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131788377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 827 (E827K)

Ref Sequence

ENSEMBL: ENSMUSP00000095472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]

AlphaFold

B1AUH1

Predicted Effect

probably benign
Transcript: ENSMUST00000030741
AA Change: E899K

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: E899K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097860
AA Change: E827K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: E827K

Domain	Start	End	E-Value	Type
Pfam:MAM	1	116	4.1e-30	PFAM
IG	123	211	4.93e-3	SMART
FN3	213	296	3.79e-2	SMART
FN3	312	400	2.5e-2	SMART
FN3	416	504	3.62e-8	SMART
low complexity region	555	569	N/A	INTRINSIC
low complexity region	595	605	N/A	INTRINSIC
transmembrane domain	675	697	N/A	INTRINSIC
Blast:PTPc	736	878	3e-49	BLAST
SCOP:d1jlna_	790	886	9e-19	SMART
PDB:2C7S\|A	797	878	7e-22	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000105987
AA Change: E889K

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: E889K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Meta Mutation Damage Score

0.4072

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5953:Ptpru	UTSW	4	131776837	missense	probably damaging	1.00
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
R8858:Ptpru	UTSW	4	131799514	splice site	probably benign
R8911:Ptpru	UTSW	4	131776249	missense	probably damaging	0.96
R8934:Ptpru	UTSW	4	131818986	missense	probably damaging	0.98
R9031:Ptpru	UTSW	4	131788380	missense	probably damaging	1.00
R9069:Ptpru	UTSW	4	131776254	missense	possibly damaging	0.87
R9096:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9097:Ptpru	UTSW	4	131772532	missense	probably damaging	1.00
R9151:Ptpru	UTSW	4	131794967	missense	probably benign
R9166:Ptpru	UTSW	4	131797869	missense	probably benign	0.00
R9174:Ptpru	UTSW	4	131808435	missense	probably damaging	1.00
R9242:Ptpru	UTSW	4	131803030	missense	probably damaging	1.00
R9698:Ptpru	UTSW	4	131820220	missense	probably benign	0.09
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGATAAGACTCTGATCGGGG -3'
(R):5'- ATCTGTGTGAGAGCCCCTTTC -3'

Sequencing Primer
(F):5'- TAAGACTCTGATCGGGGTGGAG -3'
(R):5'- TCCCTTCTTGCAGGAGACCAG -3'

Posted On

2017-12-01