Incidental Mutation 'R5802:Camkk2'
ID 501564
Institutional Source Beutler Lab
Gene Symbol Camkk2
Ensembl Gene ENSMUSG00000029471
Gene Name calcium/calmodulin-dependent protein kinase kinase 2, beta
Synonyms 6330570N16Rik
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.243) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 122869233-122917472 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122872307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 90 (E90G)
Ref Sequence ENSEMBL: ENSMUSP00000142717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000111668] [ENSMUST00000197373] [ENSMUST00000198029] [ENSMUST00000200109]
AlphaFold Q8C078
Predicted Effect probably benign
Transcript: ENSMUST00000031429
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111668
AA Change: E533G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471
AA Change: E533G

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197373
AA Change: E90G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142717
Gene: ENSMUSG00000029471
AA Change: E90G

DomainStartEndE-ValueType
SCOP:d1phk__ 1 41 3e-8 SMART
PDB:2ZV2|A 1 42 8e-20 PDB
Blast:S_TKc 1 48 4e-23 BLAST
low complexity region 91 109 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198029
SMART Domains Protein: ENSMUSP00000142896
Gene: ENSMUSG00000029471

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
S_TKc 18 235 8.2e-12 SMART
low complexity region 259 267 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200109
AA Change: K519E

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143732
Gene: ENSMUSG00000029471
AA Change: K519E

DomainStartEndE-ValueType
low complexity region 124 144 N/A INTRINSIC
S_TKc 165 446 1.53e-92 SMART
low complexity region 464 472 N/A INTRINSIC
low complexity region 526 539 N/A INTRINSIC
Meta Mutation Damage Score 0.0662 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
PHENOTYPE: Inactivation of this locus results in impaird long term potentiation and defects in some types of long term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Camkk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Camkk2 APN 5 122,902,013 (GRCm39) missense probably damaging 1.00
IGL02321:Camkk2 APN 5 122,902,190 (GRCm39) missense probably damaging 0.96
IGL02619:Camkk2 APN 5 122,902,298 (GRCm39) missense probably damaging 0.98
IGL03356:Camkk2 APN 5 122,881,937 (GRCm39) missense probably damaging 1.00
R0056:Camkk2 UTSW 5 122,880,261 (GRCm39) missense probably damaging 1.00
R0078:Camkk2 UTSW 5 122,895,622 (GRCm39) critical splice donor site probably null
R0344:Camkk2 UTSW 5 122,901,940 (GRCm39) missense probably benign
R1480:Camkk2 UTSW 5 122,872,341 (GRCm39) splice site probably null
R1591:Camkk2 UTSW 5 122,895,621 (GRCm39) critical splice donor site probably null
R1816:Camkk2 UTSW 5 122,872,243 (GRCm39) missense probably damaging 1.00
R1960:Camkk2 UTSW 5 122,875,575 (GRCm39) nonsense probably null
R1985:Camkk2 UTSW 5 122,902,190 (GRCm39) missense possibly damaging 0.81
R2256:Camkk2 UTSW 5 122,884,398 (GRCm39) missense probably damaging 1.00
R4297:Camkk2 UTSW 5 122,883,769 (GRCm39) critical splice donor site probably null
R4687:Camkk2 UTSW 5 122,891,787 (GRCm39) missense probably damaging 1.00
R5401:Camkk2 UTSW 5 122,884,398 (GRCm39) missense probably damaging 1.00
R6167:Camkk2 UTSW 5 122,902,187 (GRCm39) missense probably damaging 0.96
R6508:Camkk2 UTSW 5 122,884,382 (GRCm39) missense probably damaging 0.96
R7313:Camkk2 UTSW 5 122,875,574 (GRCm39) missense possibly damaging 0.55
R7504:Camkk2 UTSW 5 122,884,371 (GRCm39) missense probably damaging 1.00
R7626:Camkk2 UTSW 5 122,902,363 (GRCm39) splice site probably benign
R7664:Camkk2 UTSW 5 122,894,645 (GRCm39) missense unknown
R7698:Camkk2 UTSW 5 122,884,482 (GRCm39) missense probably damaging 0.96
R7805:Camkk2 UTSW 5 122,880,275 (GRCm39) missense possibly damaging 0.92
R7937:Camkk2 UTSW 5 122,902,097 (GRCm39) missense probably benign 0.01
R8289:Camkk2 UTSW 5 122,894,689 (GRCm39) missense probably damaging 1.00
R8726:Camkk2 UTSW 5 122,882,002 (GRCm39) missense probably benign 0.19
R8852:Camkk2 UTSW 5 122,891,820 (GRCm39) missense probably damaging 1.00
R9748:Camkk2 UTSW 5 122,872,182 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCTGCTATGGAAACGCAG -3'
(R):5'- TACAGGGGAGGCAAAGTCTTTG -3'

Sequencing Primer
(F):5'- TGGTCCACGCAGCTACTC -3'
(R):5'- TAACCCGTGGGAATGTG -3'
Posted On 2017-12-01