Mutagenetix > Incidental Mutations

Incidental Mutation 'R5802:Slc6a4'

501566

Institutional Source

Beutler Lab

Gene Symbol

Slc6a4

Ensembl Gene

ENSMUSG00000020838

Gene Name

solute carrier family 6 (neurotransmitter transporter, serotonin), member 4

Synonyms

5-HTT, Sert, Htt

MMRRC Submission

043391-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R5802 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

76998603-77032340 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 77019236 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 439 (T439M)

Ref Sequence

ENSEMBL: ENSMUSP00000104039 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021195
AA Change: T439M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: T439M

Domain	Start	End	E-Value	Type
Pfam:5HT_transport_N	24	64	3e-27	PFAM
Pfam:SNF	79	600	7.3e-232	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108402
AA Change: T439M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: T439M

Domain	Start	End	E-Value	Type
Pfam:5HT_transporter	23	64	7.8e-30	PFAM
Pfam:SNF	79	600	7.3e-232	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137819

Meta Mutation Damage Score

0.6105

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Slc6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Slc6a4	APN	11	77023180	missense	probably benign	0.00
IGL01403:Slc6a4	APN	11	77031672	missense	probably benign	0.00
IGL01608:Slc6a4	APN	11	77027135	missense	probably damaging	1.00
IGL01759:Slc6a4	APN	11	77013288	missense	probably damaging	1.00
IGL02239:Slc6a4	APN	11	77027156	missense	probably benign	0.01
IGL02491:Slc6a4	APN	11	77027208	missense	probably damaging	1.00
IGL03221:Slc6a4	APN	11	77027105	missense	probably benign
R1122:Slc6a4	UTSW	11	77027186	missense	possibly damaging	0.90
R1574:Slc6a4	UTSW	11	77019196	missense	possibly damaging	0.93
R1574:Slc6a4	UTSW	11	77019196	missense	possibly damaging	0.93
R1768:Slc6a4	UTSW	11	77013252	missense	probably damaging	1.00
R1876:Slc6a4	UTSW	11	77015164	missense	probably benign	0.34
R1884:Slc6a4	UTSW	11	77013375	missense	probably benign	0.01
R4362:Slc6a4	UTSW	11	77017078	missense	probably damaging	1.00
R4595:Slc6a4	UTSW	11	77019863	missense	probably benign	0.16
R4855:Slc6a4	UTSW	11	77013309	missense	probably damaging	1.00
R5569:Slc6a4	UTSW	11	77023255	missense	possibly damaging	0.88
R5747:Slc6a4	UTSW	11	77010511	missense	probably damaging	0.97
R6242:Slc6a4	UTSW	11	77018358	nonsense	probably null
R6344:Slc6a4	UTSW	11	77018254	missense	probably damaging	1.00
R6443:Slc6a4	UTSW	11	77023201	missense	probably benign	0.05
R6935:Slc6a4	UTSW	11	77027168	missense	probably benign	0.06
R7283:Slc6a4	UTSW	11	77010696	missense	probably benign
R7313:Slc6a4	UTSW	11	77010701	missense	possibly damaging	0.75
R7347:Slc6a4	UTSW	11	77017085	nonsense	probably null
R7535:Slc6a4	UTSW	11	77015150	missense	possibly damaging	0.70
R7826:Slc6a4	UTSW	11	77013025	missense	probably benign	0.27
R8055:Slc6a4	UTSW	11	77010598	missense	probably benign	0.00
RF007:Slc6a4	UTSW	11	77019182	missense	probably damaging	1.00
Z1177:Slc6a4	UTSW	11	77016683	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTCTCTCAATAGCTTGGTAGG -3'
(R):5'- ACCCTGTAAAGTACCCAGTGC -3'

Sequencing Primer
(F):5'- CTCAATAGCTTGGTAGGATGGAACTC -3'
(R):5'- TGCACAAGGTACCATTGCTG -3'

Posted On

2017-12-01