Incidental Mutation 'R5802:Lats2'
ID501567
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Namelarge tumor suppressor 2
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5802 (G1)
Quality Score160
Status Validated
Chromosome14
Chromosomal Location57689662-57758388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57694418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 848 (Y848N)
Ref Sequence ENSEMBL: ENSMUSP00000133976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174213] [ENSMUST00000174694]
Predicted Effect probably damaging
Transcript: ENSMUST00000022531
AA Change: Y848N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: Y848N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172474
Predicted Effect probably benign
Transcript: ENSMUST00000173964
SMART Domains Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
Pfam:Pkinase 233 288 2.3e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173990
AA Change: Y848N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: Y848N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174213
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174694
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57691569 missense probably benign 0.09
IGL02104:Lats2 APN 14 57734012 missense probably damaging 1.00
IGL02173:Lats2 APN 14 57697260 missense probably damaging 1.00
IGL02377:Lats2 APN 14 57691595 missense probably damaging 1.00
IGL02995:Lats2 APN 14 57700348 missense probably damaging 1.00
R6846_Lats2_781 UTSW 14 57696134 missense probably damaging 1.00
PIT4472001:Lats2 UTSW 14 57699357 nonsense probably null
R0653:Lats2 UTSW 14 57700196 nonsense probably null
R0780:Lats2 UTSW 14 57691296 missense probably damaging 1.00
R1129:Lats2 UTSW 14 57700333 missense possibly damaging 0.71
R1851:Lats2 UTSW 14 57697455 missense probably damaging 1.00
R1882:Lats2 UTSW 14 57697354 missense probably damaging 1.00
R2184:Lats2 UTSW 14 57691559 missense probably damaging 0.99
R3498:Lats2 UTSW 14 57722466 missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57691541 missense probably damaging 1.00
R4212:Lats2 UTSW 14 57696255 missense possibly damaging 0.82
R4357:Lats2 UTSW 14 57699383 missense probably damaging 1.00
R4962:Lats2 UTSW 14 57699592 missense probably damaging 1.00
R5394:Lats2 UTSW 14 57691353 missense probably benign 0.10
R5477:Lats2 UTSW 14 57699553 missense probably benign 0.00
R5729:Lats2 UTSW 14 57722735 missense probably benign 0.04
R5931:Lats2 UTSW 14 57696131 missense probably damaging 1.00
R6016:Lats2 UTSW 14 57734175 missense probably damaging 1.00
R6376:Lats2 UTSW 14 57722509 missense probably benign 0.00
R6624:Lats2 UTSW 14 57694312 critical splice donor site probably null
R6638:Lats2 UTSW 14 57699365 missense probably damaging 1.00
R6846:Lats2 UTSW 14 57696134 missense probably damaging 1.00
R7198:Lats2 UTSW 14 57697125 missense probably damaging 1.00
R7233:Lats2 UTSW 14 57722694 splice site probably null
R7883:Lats2 UTSW 14 57697200 missense probably damaging 1.00
R8081:Lats2 UTSW 14 57700511 missense probably damaging 1.00
R8356:Lats2 UTSW 14 57697410 missense probably damaging 1.00
R8508:Lats2 UTSW 14 57722705 missense probably benign 0.08
R8536:Lats2 UTSW 14 57703038 missense probably damaging 1.00
R8767:Lats2 UTSW 14 57694324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTCTAGTCTATGTGTTGCAAG -3'
(R):5'- TAAGAAAGCCCACGTGTCTG -3'

Sequencing Primer
(F):5'- TTGCAAGAGGTCCGAAACTGTC -3'
(R):5'- CCACGTGTCTGTTGCCTGTG -3'
Posted On2017-12-01