Incidental Mutation 'R5802:Lats2'
ID 501567
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Name large tumor suppressor 2
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5802 (G1)
Quality Score 160
Status Validated
Chromosome 14
Chromosomal Location 57927119-57983669 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57931875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 848 (Y848N)
Ref Sequence ENSEMBL: ENSMUSP00000133976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174213] [ENSMUST00000174694]
AlphaFold Q7TSJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000022531
AA Change: Y848N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: Y848N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172474
Predicted Effect probably benign
Transcript: ENSMUST00000173964
SMART Domains Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
Pfam:Pkinase 233 288 2.3e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173990
AA Change: Y848N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: Y848N

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174213
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174694
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Meta Mutation Damage Score 0.9730 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57,929,026 (GRCm39) missense probably benign 0.09
IGL02104:Lats2 APN 14 57,971,469 (GRCm39) missense probably damaging 1.00
IGL02173:Lats2 APN 14 57,934,717 (GRCm39) missense probably damaging 1.00
IGL02377:Lats2 APN 14 57,929,052 (GRCm39) missense probably damaging 1.00
IGL02995:Lats2 APN 14 57,937,805 (GRCm39) missense probably damaging 1.00
Morpheus UTSW 14 57,933,591 (GRCm39) missense probably damaging 1.00
PIT4472001:Lats2 UTSW 14 57,936,814 (GRCm39) nonsense probably null
R0653:Lats2 UTSW 14 57,937,653 (GRCm39) nonsense probably null
R0780:Lats2 UTSW 14 57,928,753 (GRCm39) missense probably damaging 1.00
R1129:Lats2 UTSW 14 57,937,790 (GRCm39) missense possibly damaging 0.71
R1851:Lats2 UTSW 14 57,934,912 (GRCm39) missense probably damaging 1.00
R1882:Lats2 UTSW 14 57,934,811 (GRCm39) missense probably damaging 1.00
R2184:Lats2 UTSW 14 57,929,016 (GRCm39) missense probably damaging 0.99
R3498:Lats2 UTSW 14 57,959,923 (GRCm39) missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57,928,998 (GRCm39) missense probably damaging 1.00
R4212:Lats2 UTSW 14 57,933,712 (GRCm39) missense possibly damaging 0.82
R4357:Lats2 UTSW 14 57,936,840 (GRCm39) missense probably damaging 1.00
R4962:Lats2 UTSW 14 57,937,049 (GRCm39) missense probably damaging 1.00
R5394:Lats2 UTSW 14 57,928,810 (GRCm39) missense probably benign 0.10
R5477:Lats2 UTSW 14 57,937,010 (GRCm39) missense probably benign 0.00
R5729:Lats2 UTSW 14 57,960,192 (GRCm39) missense probably benign 0.04
R5931:Lats2 UTSW 14 57,933,588 (GRCm39) missense probably damaging 1.00
R6016:Lats2 UTSW 14 57,971,632 (GRCm39) missense probably damaging 1.00
R6376:Lats2 UTSW 14 57,959,966 (GRCm39) missense probably benign 0.00
R6624:Lats2 UTSW 14 57,931,769 (GRCm39) critical splice donor site probably null
R6638:Lats2 UTSW 14 57,936,822 (GRCm39) missense probably damaging 1.00
R6846:Lats2 UTSW 14 57,933,591 (GRCm39) missense probably damaging 1.00
R7198:Lats2 UTSW 14 57,934,582 (GRCm39) missense probably damaging 1.00
R7233:Lats2 UTSW 14 57,960,151 (GRCm39) splice site probably null
R7883:Lats2 UTSW 14 57,934,657 (GRCm39) missense probably damaging 1.00
R8081:Lats2 UTSW 14 57,937,968 (GRCm39) missense probably damaging 1.00
R8356:Lats2 UTSW 14 57,934,867 (GRCm39) missense probably damaging 1.00
R8508:Lats2 UTSW 14 57,960,162 (GRCm39) missense probably benign 0.08
R8536:Lats2 UTSW 14 57,940,495 (GRCm39) missense probably damaging 1.00
R8767:Lats2 UTSW 14 57,931,781 (GRCm39) missense probably damaging 1.00
R9579:Lats2 UTSW 14 57,937,191 (GRCm39) missense probably damaging 1.00
R9643:Lats2 UTSW 14 57,936,875 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCATCTCTAGTCTATGTGTTGCAAG -3'
(R):5'- TAAGAAAGCCCACGTGTCTG -3'

Sequencing Primer
(F):5'- TTGCAAGAGGTCCGAAACTGTC -3'
(R):5'- CCACGTGTCTGTTGCCTGTG -3'
Posted On 2017-12-01