Incidental Mutation 'R5819:Abca4'
ID501576
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 043399-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122136981 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1376 (I1376F)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: I1376F

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: I1376F

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141135
AA Change: I168F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: I168F

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198484
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CGAGCATGGCATATGTTCAGG -3'
(R):5'- TAGCAGGCATACAGTCCAGG -3'

Sequencing Primer
(F):5'- AGCATGGCATATGTTCAGGTTTATC -3'
(R):5'- CAGTCCAGGCATATCACATGTTAAGG -3'
Posted On2017-12-01