Incidental Mutation 'R5819:Trnau1ap'
ID501577
Institutional Source Beutler Lab
Gene Symbol Trnau1ap
Ensembl Gene ENSMUSG00000028898
Gene NametRNA selenocysteine 1 associated protein 1
SynonymsTrspap1, 1110007F05Rik, SECp43
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132311763-132329538 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 132325210 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030730] [ENSMUST00000105960] [ENSMUST00000105962] [ENSMUST00000125513] [ENSMUST00000127402] [ENSMUST00000137520] [ENSMUST00000147652]
Predicted Effect silent
Transcript: ENSMUST00000030730
SMART Domains Protein: ENSMUSP00000030730
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
RRM 97 171 2.2e-11 SMART
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000105960
SMART Domains Protein: ENSMUSP00000101580
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
PDB:2DHG|A 21 70 9e-25 PDB
SCOP:d1fj7a_ 22 70 7e-7 SMART
Blast:RRM 31 70 2e-21 BLAST
Predicted Effect silent
Transcript: ENSMUST00000105962
SMART Domains Protein: ENSMUSP00000101582
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
PDB:2DHG|A 87 137 7e-24 PDB
SCOP:d1cvja1 97 137 9e-5 SMART
Blast:RRM 97 138 2e-20 BLAST
low complexity region 145 164 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125513
Predicted Effect silent
Transcript: ENSMUST00000127402
SMART Domains Protein: ENSMUSP00000120657
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
low complexity region 101 120 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131524
Predicted Effect probably benign
Transcript: ENSMUST00000137520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146166
Predicted Effect probably benign
Transcript: ENSMUST00000147652
SMART Domains Protein: ENSMUSP00000127273
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 1.73e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150959
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an allele lacking exons 7 and 8 exhibit prenatal lethality. Mice homozygous for a conditional allele activated in neurons exhibit impaired performance on a rotarod. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Trnau1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trnau1ap APN 4 132328506 missense possibly damaging 0.95
IGL01926:Trnau1ap APN 4 132319562 missense probably benign 0.39
IGL01970:Trnau1ap APN 4 132313987 splice site probably benign
IGL02336:Trnau1ap APN 4 132314020 nonsense probably null
IGL03248:Trnau1ap APN 4 132321803 missense probably damaging 1.00
IGL03046:Trnau1ap UTSW 4 132311941 missense probably damaging 1.00
R0079:Trnau1ap UTSW 4 132314345 missense probably damaging 1.00
R1940:Trnau1ap UTSW 4 132321803 missense probably damaging 1.00
R2849:Trnau1ap UTSW 4 132321734 missense possibly damaging 0.69
R4683:Trnau1ap UTSW 4 132321752 missense probably damaging 1.00
R5056:Trnau1ap UTSW 4 132327171 intron probably benign
R6803:Trnau1ap UTSW 4 132321770 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTTACATGTGGGAGGTGG -3'
(R):5'- AGAGGGTTACATTCTGCTCTTCC -3'

Sequencing Primer
(F):5'- GAATACATGAGACTGTCCTGTGCC -3'
(R):5'- CTCATAGAACCATGGAGCTGGC -3'
Posted On2017-12-01