Incidental Mutation 'R5819:Rgl3'
ID501578
Institutional Source Beutler Lab
Gene Symbol Rgl3
Ensembl Gene ENSMUSG00000040146
Gene Nameral guanine nucleotide dissociation stimulator-like 3
Synonyms1300003D20Rik
MMRRC Submission 043399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5819 (G1)
Quality Score214
Status Not validated
Chromosome9
Chromosomal Location21968711-21989446 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 21981602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045726] [ENSMUST00000045726] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably null
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213130
Predicted Effect probably benign
Transcript: ENSMUST00000214026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Olfr1275 A T 2: 111,230,959 I278N probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Rgl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rgl3 APN 9 21977239 missense probably damaging 1.00
IGL00770:Rgl3 APN 9 21987722 splice site probably benign
IGL00774:Rgl3 APN 9 21987722 splice site probably benign
IGL02071:Rgl3 APN 9 21988263 missense probably benign 0.00
IGL02172:Rgl3 APN 9 21976838 missense probably damaging 1.00
IGL02190:Rgl3 APN 9 21981708 missense probably benign 0.00
IGL02277:Rgl3 APN 9 21974109 missense probably damaging 1.00
IGL02515:Rgl3 APN 9 21974100 missense possibly damaging 0.93
R0077:Rgl3 UTSW 9 21974102 missense probably benign 0.00
R0126:Rgl3 UTSW 9 21975812 missense probably benign 0.06
R0360:Rgl3 UTSW 9 21976857 missense probably damaging 0.97
R0421:Rgl3 UTSW 9 21976032 missense probably benign 0.06
R0556:Rgl3 UTSW 9 21975844 nonsense probably null
R0751:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1184:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1548:Rgl3 UTSW 9 21980706 missense probably benign 0.11
R2176:Rgl3 UTSW 9 21975958 utr 3 prime probably benign
R3154:Rgl3 UTSW 9 21980774 missense probably damaging 1.00
R3607:Rgl3 UTSW 9 21987691 missense probably damaging 0.98
R3803:Rgl3 UTSW 9 21976025 missense probably damaging 1.00
R3958:Rgl3 UTSW 9 21975589 intron probably benign
R4081:Rgl3 UTSW 9 21987675 missense possibly damaging 0.79
R4937:Rgl3 UTSW 9 21987708 nonsense probably null
R5068:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5070:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5217:Rgl3 UTSW 9 21987648 makesense probably null
R5772:Rgl3 UTSW 9 21981612 missense probably benign 0.00
R6509:Rgl3 UTSW 9 21971908 missense probably benign 0.00
R7425:Rgl3 UTSW 9 21976827 nonsense probably null
R7744:Rgl3 UTSW 9 21987570 missense probably benign 0.00
R7883:Rgl3 UTSW 9 21981427 missense probably benign 0.00
R8339:Rgl3 UTSW 9 21987529 missense probably benign
R8383:Rgl3 UTSW 9 21977233 missense probably damaging 1.00
X0019:Rgl3 UTSW 9 21981479 missense probably benign
Z1176:Rgl3 UTSW 9 21981403 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGCACTGTGGGAGAGATG -3'
(R):5'- CACAGCCACATGCCCTGG -3'

Sequencing Primer
(F):5'- ACTGTGGGAGAGATGCCTGC -3'
(R):5'- GTCCGAGTATATGTCAGCACATCG -3'
Posted On2017-12-01