Incidental Mutation 'R5837:Ift140'
ID501589
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5837 (G1)
Quality Score123
Status Validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25089540 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1048 (K1048E)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: K1048E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: K1048E

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000137386
AA Change: K1048E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: K1048E

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Meta Mutation Damage Score 0.1888 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATAAGACCTGGGTGCTCTGG -3'
(R):5'- CCAGAAGCACTCTTAATAACATTGA -3'

Sequencing Primer
(F):5'- GCTCTGGGCCTTTGTAGG -3'
(R):5'- TTGATGCTGTGCACACCAAG -3'
Posted On2017-12-01