Mutagenetix > Incidental Mutation

Incidental Mutation 'R5837:Ift140'

501589

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

044057-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5837 (G1)

Quality Score

123

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25089540 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1048 (K1048E)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably damaging
Transcript: ENSMUST00000024983
AA Change: K1048E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: K1048E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000137386
AA Change: K1048E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: K1048E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139300

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.1888

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Ank1	A	G	8: 23,104,790	N605D	probably damaging	Het
Apob	A	G	12: 8,003,277	M1240V	probably benign	Het
Atf1	T	A	15: 100,254,384	I86N	probably damaging	Het
Best1	T	A	19: 9,989,119		probably null	Het
Bet1l	C	A	7: 140,854,781	R51L	probably benign	Het
Bpifa5	A	G	2: 154,163,678	Y60C	probably damaging	Het
Ccdc141	G	T	2: 77,108,437	Q275K	possibly damaging	Het
Cep295	T	A	9: 15,346,984	H241L	probably damaging	Het
Commd7	A	G	2: 153,629,224	V36A	possibly damaging	Het
Cyld	G	A	8: 88,741,404	S555N	probably damaging	Het
Cyp2j13	A	T	4: 96,071,682	I79N	probably damaging	Het
Dact2	A	G	17: 14,196,253	S562P	probably damaging	Het
Diexf	A	T	1: 193,118,393	F373Y	probably damaging	Het
Dnajc13	T	A	9: 104,176,666	I1664F	possibly damaging	Het
Ehmt1	A	G	2: 24,863,914	V277A	probably damaging	Het
Fbn1	A	T	2: 125,379,134		probably null	Het
Galnt6	G	A	15: 100,694,646	T560M	possibly damaging	Het
Glra1	G	T	11: 55,536,507		probably null	Het
Gm10762	C	T	2: 128,967,157		probably benign	Het
Greb1	C	T	12: 16,688,585	R1459H	probably damaging	Het
Ilk	T	C	7: 105,741,171		probably null	Het
Lgi4	C	T	7: 31,070,783		probably benign	Het
Loxhd1	A	G	18: 77,286,409	T59A	possibly damaging	Het
Lzic	G	T	4: 149,486,000		probably null	Het
Mef2d	A	G	3: 88,161,781	T286A	probably benign	Het
Mycbp2	C	A	14: 103,124,403	C4447F	probably damaging	Het
Ncoa2	A	G	1: 13,224,706		probably benign	Het
Nolc1	T	C	19: 46,083,183		probably benign	Het
Npl	T	C	1: 153,503,525	T271A	probably benign	Het
Nudt1	A	G	5: 140,334,540	R25G	probably damaging	Het
Nudt19	T	C	7: 35,551,636	E226G	possibly damaging	Het
Oc90	T	C	15: 65,876,446	D405G	probably benign	Het
Olfr1111	A	T	2: 87,150,355	F102Y	probably benign	Het
Olfr1491	T	A	19: 13,704,960	C44*	probably null	Het
Olfr376	A	G	11: 73,375,648	M300V	probably benign	Het
Olfr826	A	T	10: 130,180,397	L161H	probably damaging	Het
Pcdhb1	T	C	18: 37,265,827	I277T	possibly damaging	Het
Pcdhb9	C	A	18: 37,402,798	A615E	probably damaging	Het
Phrf1	C	G	7: 141,260,061	D1056E	probably benign	Het
Phyhip	C	A	14: 70,467,010	A223E	probably damaging	Het
Polr2h	T	A	16: 20,717,932	I4N	probably damaging	Het
Ppp1r12c	C	A	7: 4,497,404		probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Psg17	T	A	7: 18,820,215	T37S	possibly damaging	Het
Ptprz1	T	C	6: 23,001,418	V1169A	probably benign	Het
Rabgap1l	T	C	1: 160,307,222		probably benign	Het
Rapgef3	C	T	15: 97,757,342		probably benign	Het
Rbp3	C	A	14: 33,954,273	H59Q	probably benign	Het
Robo3	T	A	9: 37,429,816		probably null	Het
Slco4c1	C	T	1: 96,818,982	E712K	probably benign	Het
Ssh3	T	C	19: 4,266,400	T168A	probably benign	Het
Stoml2	G	T	4: 43,028,989	N248K	probably damaging	Het
Tmigd1	A	G	11: 76,916,085		probably benign	Het
Tnc	T	A	4: 64,013,214	D753V	probably damaging	Het
Tnik	A	T	3: 28,668,053		probably benign	Het
Treml1	A	G	17: 48,360,152	S22G	possibly damaging	Het
Trmt2a	C	T	16: 18,249,462		probably benign	Het
Ttn	T	C	2: 76,717,374	T32151A	probably damaging	Het
Vmn1r67	T	C	7: 10,447,022	I10T	probably benign	Het
Vmn2r116	T	C	17: 23,387,080	F322S	probably damaging	Het
Wdr19	A	G	5: 65,202,957	D35G	probably benign	Het
Zfp365	A	T	10: 67,889,040	H339Q	probably damaging	Het
Zfp677	A	T	17: 21,397,386	H235L	probably damaging	Het
Zpbp2	G	A	11: 98,551,271		probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGATAAGACCTGGGTGCTCTGG -3'
(R):5'- CCAGAAGCACTCTTAATAACATTGA -3'

Sequencing Primer
(F):5'- GCTCTGGGCCTTTGTAGG -3'
(R):5'- TTGATGCTGTGCACACCAAG -3'

Posted On

2017-12-01