Incidental Mutation 'R5824:Gpr161'
ID501601
Institutional Source Beutler Lab
Gene Symbol Gpr161
Ensembl Gene ENSMUSG00000040836
Gene NameG protein-coupled receptor 161
SynonymsLOC240888, vl
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5824 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165295789-165326745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 165310991 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 382 (T382K)
Ref Sequence ENSEMBL: ENSMUSP00000136621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111450
AA Change: T365K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: T365K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178700
AA Change: T382K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: T382K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 63 273 1.5e-7 PFAM
Pfam:7tm_1 72 352 9.2e-48 PFAM
low complexity region 491 504 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Upk3bl T A 5: 136,060,279 Y196* probably null Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Gpr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Gpr161 APN 1 165318803 missense probably benign
IGL01090:Gpr161 APN 1 165306580 missense probably damaging 1.00
IGL01151:Gpr161 APN 1 165321509 missense probably damaging 1.00
IGL01763:Gpr161 APN 1 165317251 missense probably benign 0.09
IGL03206:Gpr161 APN 1 165321649 missense probably damaging 1.00
IGL03279:Gpr161 APN 1 165310529 missense probably damaging 1.00
IGL03378:Gpr161 APN 1 165310508 missense probably damaging 0.99
IGL03147:Gpr161 UTSW 1 165317308 missense probably benign 0.30
R0367:Gpr161 UTSW 1 165317236 splice site probably benign
R1827:Gpr161 UTSW 1 165306567 missense possibly damaging 0.94
R1970:Gpr161 UTSW 1 165306358 missense probably damaging 0.97
R1991:Gpr161 UTSW 1 165306563 missense probably damaging 0.98
R2425:Gpr161 UTSW 1 165310623 missense possibly damaging 0.83
R4805:Gpr161 UTSW 1 165306460 missense probably damaging 1.00
R5416:Gpr161 UTSW 1 165321461 missense probably benign 0.00
R5546:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5547:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R6152:Gpr161 UTSW 1 165310295 missense possibly damaging 0.58
R6658:Gpr161 UTSW 1 165306567 missense possibly damaging 0.50
R6924:Gpr161 UTSW 1 165321619 missense possibly damaging 0.83
R7128:Gpr161 UTSW 1 165310457 missense possibly damaging 0.92
R7216:Gpr161 UTSW 1 165306546 missense probably benign 0.22
R7540:Gpr161 UTSW 1 165318835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGTCCTTTACCAGTGC -3'
(R):5'- CATTCTCCAGGGATGGGTAC -3'

Sequencing Primer
(F):5'- TACCAGTGCCATCTGCCAC -3'
(R):5'- ACCAGGGGCTATTGTGTCCTC -3'
Posted On2017-12-01