Incidental Mutation 'R5824:Upk3bl'
ID501602
Institutional Source Beutler Lab
Gene Symbol Upk3bl
Ensembl Gene ENSMUSG00000006143
Gene Nameuroplakin 3B-like
Synonyms
MMRRC Submission 043216-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5824 (G1)
Quality Score132
Status Not validated
Chromosome5
Chromosomal Location136054492-136064326 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 136060279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 196 (Y196*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006303] [ENSMUST00000111137] [ENSMUST00000122979]
Predicted Effect probably null
Transcript: ENSMUST00000006303
AA Change: Y151*
SMART Domains Protein: ENSMUSP00000006303
Gene: ENSMUSG00000006143
AA Change: Y151*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1apxa_ 42 116 1e-4 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111137
AA Change: Y215*
SMART Domains Protein: ENSMUSP00000106767
Gene: ENSMUSG00000006143
AA Change: Y215*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
SCOP:d1apxa_ 106 180 2e-4 SMART
transmembrane domain 257 279 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122979
AA Change: Y53*
SMART Domains Protein: ENSMUSP00000122206
Gene: ENSMUSG00000006143
AA Change: Y53*

DomainStartEndE-ValueType
transmembrane domain 95 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139999
Predicted Effect probably null
Transcript: ENSMUST00000156530
AA Change: Y196*
SMART Domains Protein: ENSMUSP00000123311
Gene: ENSMUSG00000006143
AA Change: Y196*

DomainStartEndE-ValueType
SCOP:d1apxa_ 73 147 2e-4 SMART
transmembrane domain 224 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A T 13: 59,466,099 H66Q probably damaging Het
Ap1g1 T A 8: 109,838,912 probably null Het
Ap4b1 A T 3: 103,813,385 I124F probably benign Het
Arhgap10 A T 8: 77,358,552 Y462* probably null Het
BC067074 T A 13: 113,368,620 H2094Q probably damaging Het
Btnl10 G T 11: 58,923,440 M315I probably benign Het
Cep295 A G 9: 15,325,656 V1994A possibly damaging Het
Cherp G A 8: 72,462,258 probably benign Het
Ckap5 G A 2: 91,559,136 A318T probably benign Het
Cma1 T C 14: 55,941,725 K238E possibly damaging Het
Ctif T C 18: 75,610,678 D141G possibly damaging Het
Ctnna1 T C 18: 35,179,886 S264P probably benign Het
Dnah12 G T 14: 26,770,518 probably null Het
Dnah5 A G 15: 28,313,821 T1928A probably benign Het
Etfdh G A 3: 79,609,945 P379L probably damaging Het
Gfra3 T C 18: 34,711,211 N92S probably damaging Het
Gm15448 T C 7: 3,824,754 T135A probably damaging Het
Gpr161 C A 1: 165,310,991 T382K possibly damaging Het
Gspt2 T C X: 94,636,465 V70A possibly damaging Het
Hmcn1 A G 1: 150,993,023 V10A probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kpna1 A G 16: 36,020,205 D205G possibly damaging Het
Man2a2 T G 7: 80,353,032 D1067A probably benign Het
Map3k4 G A 17: 12,229,639 H1551Y probably damaging Het
Moxd1 A T 10: 24,287,097 I486F probably damaging Het
Notch3 G T 17: 32,153,861 R579S possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Olfr808 T C 10: 129,768,381 V295A probably damaging Het
Olfr878 A G 9: 37,919,565 T308A probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Reg3b G A 6: 78,372,121 V77I possibly damaging Het
Terb1 T C 8: 104,485,447 T301A probably benign Het
Tmem260 G A 14: 48,505,328 C540Y probably damaging Het
Tmprss15 A T 16: 79,034,313 F385I probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Vmn1r199 A T 13: 22,383,578 K304N probably benign Het
Other mutations in Upk3bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0085:Upk3bl UTSW 5 136060115 missense probably benign 0.00
R0539:Upk3bl UTSW 5 136063986 intron probably benign
R0554:Upk3bl UTSW 5 136059794 missense probably damaging 1.00
R0559:Upk3bl UTSW 5 136057476 missense probably benign 0.06
R0835:Upk3bl UTSW 5 136057331 missense probably benign 0.00
R1881:Upk3bl UTSW 5 136057303 missense probably benign 0.00
R4729:Upk3bl UTSW 5 136057393 missense probably benign 0.03
R4947:Upk3bl UTSW 5 136057245 unclassified probably benign
R5120:Upk3bl UTSW 5 136064191 utr 3 prime probably benign
R5243:Upk3bl UTSW 5 136060123 missense possibly damaging 0.73
R5523:Upk3bl UTSW 5 136060100 missense probably damaging 0.98
R6210:Upk3bl UTSW 5 136059820 nonsense probably null
R6229:Upk3bl UTSW 5 136064061 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAACTTTGACCGCAATGG -3'
(R):5'- TGGCAATCTAGCTTTTCCAGG -3'

Sequencing Primer
(F):5'- AATGGCTACTATCTCACGCTGAGG -3'
(R):5'- AATCTAGCTTTTCCAGGGCCCAAG -3'
Posted On2017-12-01