Incidental Mutation 'R5827:Mfsd6'
ID501609
Institutional Source Beutler Lab
Gene Symbol Mfsd6
Ensembl Gene ENSMUSG00000041439
Gene Namemajor facilitator superfamily domain containing 6
SynonymsMMR2, 9630025I22Rik, 2210010L05Rik
MMRRC Submission 043218-MU
Accession Numbers

Ncbi RefSeq: NM_133829.2, NM_178081.4; MGI:1922925

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location52656286-52727462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52662392 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 633 (E633G)
Ref Sequence ENSEMBL: ENSMUSP00000122881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087701] [ENSMUST00000156876]
Predicted Effect probably benign
Transcript: ENSMUST00000087701
AA Change: E633G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084991
Gene: ENSMUSG00000041439
AA Change: E633G

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 4.8e-19 PFAM
Pfam:MFS_1 70 162 7e-11 PFAM
Pfam:MFS_2 72 571 3.8e-13 PFAM
Pfam:Nuc_H_symport 424 628 1.1e-11 PFAM
Pfam:MFS_1 453 708 6.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147758
AA Change: E463G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000115398
Gene: ENSMUSG00000041439
AA Change: E463G

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
Pfam:Nuc_H_symport 255 459 1.4e-11 PFAM
Pfam:MFS_1 284 539 6.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149887
Predicted Effect probably damaging
Transcript: ENSMUST00000156876
AA Change: E633G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122881
Gene: ENSMUSG00000041439
AA Change: E633G

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 6.2e-20 PFAM
Pfam:MFS_1 70 162 1.8e-10 PFAM
low complexity region 258 270 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 369 388 N/A INTRINSIC
Pfam:Nuc_H_symport 424 628 2.6e-11 PFAM
Pfam:MFS_1 453 707 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188126
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Mfsd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Mfsd6 APN 1 52708254 missense probably damaging 1.00
IGL00820:Mfsd6 APN 1 52708306 missense probably damaging 1.00
IGL01518:Mfsd6 APN 1 52709322 missense probably damaging 1.00
IGL02111:Mfsd6 APN 1 52708344 missense probably damaging 1.00
IGL02517:Mfsd6 APN 1 52663277 splice site probably benign
IGL02687:Mfsd6 APN 1 52708675 missense probably damaging 0.99
IGL02887:Mfsd6 APN 1 52708878 missense probably benign 0.19
IGL02901:Mfsd6 APN 1 52708473 missense probably benign 0.07
IGL03030:Mfsd6 APN 1 52709703 start codon destroyed probably null 1.00
PIT4280001:Mfsd6 UTSW 1 52660880 missense probably benign 0.00
PIT4466001:Mfsd6 UTSW 1 52708897 missense probably benign 0.03
R0043:Mfsd6 UTSW 1 52708652 nonsense probably null
R0113:Mfsd6 UTSW 1 52709189 missense probably damaging 1.00
R0226:Mfsd6 UTSW 1 52658690 intron probably benign
R0302:Mfsd6 UTSW 1 52709457 missense probably damaging 1.00
R0613:Mfsd6 UTSW 1 52658696 intron probably benign
R1126:Mfsd6 UTSW 1 52709511 missense probably benign 0.16
R1368:Mfsd6 UTSW 1 52708605 missense possibly damaging 0.49
R1471:Mfsd6 UTSW 1 52709557 missense probably benign 0.32
R1733:Mfsd6 UTSW 1 52709365 missense probably damaging 1.00
R1768:Mfsd6 UTSW 1 52660805 critical splice donor site probably null
R1951:Mfsd6 UTSW 1 52709358 missense probably damaging 1.00
R2031:Mfsd6 UTSW 1 52708854 missense probably benign 0.04
R2116:Mfsd6 UTSW 1 52660975 missense probably benign 0.21
R2240:Mfsd6 UTSW 1 52660819 missense probably damaging 0.97
R2242:Mfsd6 UTSW 1 52709598 missense probably benign 0.03
R2303:Mfsd6 UTSW 1 52676513 missense probably damaging 0.98
R2382:Mfsd6 UTSW 1 52708410 missense probably benign 0.10
R4568:Mfsd6 UTSW 1 52663289 nonsense probably null
R4801:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4802:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4958:Mfsd6 UTSW 1 52661024 missense probably damaging 1.00
R5134:Mfsd6 UTSW 1 52708356 missense possibly damaging 0.80
R5844:Mfsd6 UTSW 1 52658383 missense probably benign
R6124:Mfsd6 UTSW 1 52708252 missense probably damaging 1.00
R6435:Mfsd6 UTSW 1 52709444 nonsense probably null
R6515:Mfsd6 UTSW 1 52660961 missense probably damaging 1.00
R6874:Mfsd6 UTSW 1 52660709 missense probably benign 0.02
R6878:Mfsd6 UTSW 1 52708753 missense probably damaging 0.98
R7111:Mfsd6 UTSW 1 52709758 splice site probably null
R7170:Mfsd6 UTSW 1 52662388 critical splice donor site probably null
R7242:Mfsd6 UTSW 1 52709474 missense probably damaging 0.98
R7548:Mfsd6 UTSW 1 52663287 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGTTTACCAAGACACCACTGAG -3'
(R):5'- TGCTCAATGAACTGTCGCTTC -3'

Sequencing Primer
(F):5'- CCACTGAGAACATGATGTCTGCAG -3'
(R):5'- TTTGCCCCAGTGTTAAGACTG -3'
Posted On2017-12-01