Mutagenetix > Incidental Mutation

Incidental Mutation 'R5887:Mmrn1'

501617

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5887 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60987074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1020 (V1020A)

Ref Sequence

ENSEMBL: ENSMUSP00000119609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129603
AA Change: V1020A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: V1020A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204333

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.2%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	C	T	6: 91,915,143	Q129*	probably null	Het
Acad8	A	T	9: 26,979,324		probably null	Het
AK157302	T	C	13: 21,495,409	I35T	possibly damaging	Het
Arfgef3	G	T	10: 18,607,665	S1437*	probably null	Het
Calcrl	A	T	2: 84,370,497	W68R	probably damaging	Het
Cd59a	A	G	2: 104,104,201	R5G	probably damaging	Het
Chl1	C	T	6: 103,717,604	A1091V	probably benign	Het
Copg1	T	C	6: 87,902,297	F442L	probably damaging	Het
Creld1	T	C	6: 113,492,899	*421Q	probably null	Het
Crocc2	T	A	1: 93,194,116	H662Q	possibly damaging	Het
Csf2ra	G	A	19: 61,227,328	A13V	possibly damaging	Het
Cul3	T	C	1: 80,276,422	T546A	possibly damaging	Het
Dnah8	C	T	17: 30,794,717	P3811S	probably damaging	Het
Dock6	T	A	9: 21,820,394	H1173L	probably damaging	Het
Dpysl4	T	C	7: 139,096,276	I328T	possibly damaging	Het
Dspp	G	A	5: 104,175,455	G155R	probably damaging	Het
Fam208a	T	A	14: 27,466,297	L900*	probably null	Het
Fbxo33	A	T	12: 59,204,759	C57*	probably null	Het
Frrs1	T	A	3: 116,896,750	V14D	probably benign	Het
Gm13199	C	T	2: 5,862,302	G96S	unknown	Het
Gm609	T	A	16: 45,417,916	L178F	probably damaging	Het
Gpr155	A	T	2: 73,343,718	C754*	probably null	Het
Gpr62	A	T	9: 106,465,615	V38E	probably damaging	Het
Kcnt2	C	A	1: 140,425,366	P271H	probably damaging	Het
Kpna3	C	T	14: 61,403,012	V34I	probably benign	Het
Lamb1	C	T	12: 31,266,864	Q71*	probably null	Het
Lipk	T	C	19: 34,039,107	I245T	possibly damaging	Het
Lrp1b	T	G	2: 40,821,707	N3281T	possibly damaging	Het
Lrp5	A	C	19: 3,604,094	I1111S	probably benign	Het
Olfr1212	G	A	2: 88,958,754	C96Y	possibly damaging	Het
Olfr912	G	A	9: 38,581,784	C169Y	probably damaging	Het
Olfr954	T	C	9: 39,461,491	L17P	probably damaging	Het
Pcdha7	A	T	18: 36,975,907	T662S	probably damaging	Het
Pcdhga6	A	G	18: 37,708,559	D444G	probably damaging	Het
Pkd2	T	G	5: 104,498,539	D737E	probably damaging	Het
Plcd4	C	T	1: 74,551,090	R161W	probably damaging	Het
Prpf8	A	G	11: 75,500,908	Y1494C	possibly damaging	Het
Rad17	A	C	13: 100,633,861		probably null	Het
Rbm17	A	T	2: 11,585,674	F390Y	probably damaging	Het
Rhod	A	T	19: 4,439,287	L22Q	probably damaging	Het
Serpina1f	T	C	12: 103,689,787	D394G	possibly damaging	Het
Serpina1f	G	A	12: 103,693,631	Q131*	probably null	Het
Spocd1	A	T	4: 129,948,959	S56C	probably damaging	Het
St7l	G	A	3: 104,874,928	R207H	probably benign	Het
Tbx18	T	C	9: 87,713,513	D336G	possibly damaging	Het
Tfg	A	T	16: 56,694,416	Y135*	probably null	Het
Tjp2	A	G	19: 24,096,599	L1108P	probably benign	Het
Tmem150c	C	A	5: 100,095,665	V8L	probably benign	Het
Ttn	A	T	2: 76,916,445	H4753Q	probably benign	Het
Tyw1	T	A	5: 130,325,699	I589N	probably damaging	Het
Usp40	C	T	1: 87,999,870	R139Q	probably damaging	Het
Zgrf1	A	G	3: 127,584,765	Y174C	probably damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGTTTTGCATGAATACCCTCCC -3'
(R):5'- GTATGTCCAGCATGTGTTCGC -3'

Sequencing Primer
(F):5'- TGCATGAATACCCTCCCTAATGG -3'
(R):5'- ATGTGTTCGCGCGTGACAC -3'

Posted On

2017-12-01