Incidental Mutation 'R5888:Lair1'
ID 501619
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Name leukocyte-associated Ig-like receptor 1
Synonyms 5133400O11Rik, Lair-1, D7Bwg0421e, mLair-1
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 4006401-4066203 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4013844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 134 (D134E)
Ref Sequence ENSEMBL: ENSMUSP00000083589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
AlphaFold Q8BG84
Predicted Effect possibly damaging
Transcript: ENSMUST00000068865
AA Change: D24E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541
AA Change: D24E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086400
AA Change: D134E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: D134E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086401
AA Change: D134E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: D134E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108600
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131126
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136616
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149395
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206445
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Asap2 T A 12: 21,268,191 (GRCm39) I319N probably damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4,031,730 (GRCm39) missense probably benign 0.01
IGL01475:Lair1 APN 7 4,012,683 (GRCm39) utr 3 prime probably benign
IGL02696:Lair1 APN 7 4,013,848 (GRCm39) intron probably benign
IGL02749:Lair1 APN 7 4,031,900 (GRCm39) missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4,013,785 (GRCm39) missense probably damaging 1.00
R0703:Lair1 UTSW 7 4,013,759 (GRCm39) missense probably null 0.99
R1053:Lair1 UTSW 7 4,031,784 (GRCm39) missense probably damaging 1.00
R1332:Lair1 UTSW 7 4,013,595 (GRCm39) missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4,013,788 (GRCm39) missense probably damaging 1.00
R2022:Lair1 UTSW 7 4,066,063 (GRCm39) splice site probably null
R2509:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R3721:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R4021:Lair1 UTSW 7 4,058,915 (GRCm39) critical splice donor site probably null
R4784:Lair1 UTSW 7 4,012,731 (GRCm39) missense probably benign 0.15
R4873:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4875:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4940:Lair1 UTSW 7 4,031,948 (GRCm39) missense probably benign 0.00
R5125:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5965:Lair1 UTSW 7 4,032,023 (GRCm39) missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4,031,895 (GRCm39) missense probably benign 0.43
R6265:Lair1 UTSW 7 4,058,826 (GRCm39) intron probably benign
R6305:Lair1 UTSW 7 4,013,727 (GRCm39) critical splice donor site probably null
R6915:Lair1 UTSW 7 4,058,952 (GRCm39) missense possibly damaging 0.89
R7964:Lair1 UTSW 7 4,013,803 (GRCm39) missense probably benign 0.22
R7991:Lair1 UTSW 7 4,031,969 (GRCm39) missense probably damaging 1.00
R9414:Lair1 UTSW 7 4,013,819 (GRCm39) missense probably benign 0.09
R9787:Lair1 UTSW 7 4,013,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGAGTCCTGAGAATAGTCAG -3'
(R):5'- TCAGGCCAACACTTATGACC -3'

Sequencing Primer
(F):5'- GTCAGAATCAGTTCACATTTAGGAGG -3'
(R):5'- ACTTATGACCAGTGACACAAGG -3'
Posted On 2017-12-01