Incidental Mutation 'R5888:Asap2'
ID 501620
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene Name ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms 6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 044089-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R5888 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 21161369-21320172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21268191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 319 (I319N)
Ref Sequence ENSEMBL: ENSMUSP00000088344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
AlphaFold Q7SIG6
PDB Structure CRYSTAL STRUCTURE OF THE ARF-GAP DOMAIN AND ANKYRIN REPEATS OF PAPBETA. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050990
AA Change: I319N

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: I319N

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064595
AA Change: I319N

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: I319N

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090834
AA Change: I319N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: I319N

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101562
AA Change: I322N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: I322N

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Meta Mutation Damage Score 0.3377 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,089,095 (GRCm39) V503E possibly damaging Het
Alk C A 17: 72,181,938 (GRCm39) V1362L probably damaging Het
Ankrd55 T A 13: 112,492,453 (GRCm39) I208N possibly damaging Het
Atp11b T C 3: 35,891,696 (GRCm39) I1036T probably benign Het
B4gat1 T C 19: 5,089,560 (GRCm39) F186L probably benign Het
C3 T A 17: 57,521,831 (GRCm39) T1079S probably damaging Het
Cacul1 G T 19: 60,525,902 (GRCm39) T287K possibly damaging Het
Cbr3 G C 16: 93,487,614 (GRCm39) G266R probably damaging Het
Cd63 T A 10: 128,748,160 (GRCm39) probably null Het
Chd7 G A 4: 8,866,382 (GRCm39) M851I probably damaging Het
Chst13 T A 6: 90,286,554 (GRCm39) H136L probably benign Het
Cyp2d22 T C 15: 82,258,014 (GRCm39) T179A probably benign Het
Dclre1b A T 3: 103,711,053 (GRCm39) V286E probably damaging Het
Defb45 G A 2: 152,435,154 (GRCm39) probably benign Het
Dlg1 T C 16: 31,610,704 (GRCm39) probably null Het
Dock3 A G 9: 106,901,002 (GRCm39) V321A probably benign Het
Dytn A T 1: 63,716,396 (GRCm39) V59E possibly damaging Het
Efcab3 T C 11: 104,612,227 (GRCm39) probably benign Het
Eif2ak1 A G 5: 143,823,733 (GRCm39) I393M probably damaging Het
Fam83g A T 11: 61,593,420 (GRCm39) E318V probably benign Het
Fbxo34 T A 14: 47,767,176 (GRCm39) F179I probably damaging Het
Fmo5 T A 3: 97,549,041 (GRCm39) Y230N probably benign Het
Fzd9 T G 5: 135,278,317 (GRCm39) probably null Het
Gata2 T C 6: 88,177,722 (GRCm39) S251P probably benign Het
Gigyf1 A G 5: 137,523,959 (GRCm39) D1043G probably damaging Het
Gm10322 T A 10: 59,452,125 (GRCm39) S81T probably benign Het
Gm15517 A T 7: 43,910,066 (GRCm39) probably benign Het
Haus4 T C 14: 54,781,676 (GRCm39) T232A probably benign Het
Hgfac A T 5: 35,202,751 (GRCm39) H417L probably damaging Het
Iqgap2 T C 13: 95,772,118 (GRCm39) K1354E possibly damaging Het
Kcnk12 C A 17: 88,054,077 (GRCm39) R195L probably benign Het
Kcnn2 A T 18: 45,725,412 (GRCm39) I303F probably damaging Het
Kcnt1 T C 2: 25,798,122 (GRCm39) F879S probably damaging Het
Kndc1 T C 7: 139,475,133 (GRCm39) F11L probably benign Het
Kpna7 A G 5: 144,926,605 (GRCm39) F449S probably damaging Het
Krt77 G T 15: 101,773,888 (GRCm39) N255K probably benign Het
Lair1 A T 7: 4,013,844 (GRCm39) D134E probably damaging Het
Loxhd1 T C 18: 77,490,211 (GRCm39) V1318A probably damaging Het
Marchf10 A T 11: 105,292,972 (GRCm39) V145D possibly damaging Het
Mcpt1 T A 14: 56,256,969 (GRCm39) M169K probably benign Het
Mdc1 T A 17: 36,158,712 (GRCm39) V364E probably benign Het
Mfsd11 T C 11: 116,762,210 (GRCm39) F270S probably damaging Het
Mfsd4b2 T G 10: 39,798,031 (GRCm39) D108A probably benign Het
Mink1 A T 11: 70,500,885 (GRCm39) probably benign Het
Mmp25 T C 17: 23,850,048 (GRCm39) Y504C probably damaging Het
Ms4a13 C T 19: 11,168,870 (GRCm39) V52I probably benign Het
Msh4 C T 3: 153,573,360 (GRCm39) probably null Het
Muc5b T G 7: 141,412,158 (GRCm39) S1701R unknown Het
Naalad2 A T 9: 18,241,937 (GRCm39) S656T probably benign Het
Ncapd2 T C 6: 125,164,052 (GRCm39) Y64C probably damaging Het
Ncapg2 T A 12: 116,389,420 (GRCm39) S347T possibly damaging Het
Ndufb11b T C 15: 81,864,872 (GRCm39) S38P probably benign Het
Nipal4 T C 11: 46,042,166 (GRCm39) T172A probably damaging Het
Nrros T C 16: 31,961,905 (GRCm39) K652R probably benign Het
Nrxn3 G T 12: 89,478,855 (GRCm39) A983S possibly damaging Het
Or4a76 T A 2: 89,461,143 (GRCm39) Y33F probably damaging Het
Or4ac1-ps1 T C 2: 88,370,588 (GRCm39) noncoding transcript Het
Or4c115 T A 2: 88,928,269 (GRCm39) M1L probably damaging Het
Or4k77 T C 2: 111,199,088 (GRCm39) M37T probably benign Het
Or51m1 A G 7: 103,578,239 (GRCm39) T70A possibly damaging Het
Or8g24 A T 9: 38,989,263 (GRCm39) Y259* probably null Het
Or8k37 A C 2: 86,469,488 (GRCm39) L188R probably damaging Het
P2rx4 T A 5: 122,857,228 (GRCm39) S155T probably benign Het
P2rx4 T G 5: 122,865,271 (GRCm39) Y299D probably damaging Het
Pcsk6 A T 7: 65,693,372 (GRCm39) L7F probably null Het
Pdss2 T C 10: 43,097,793 (GRCm39) silent Het
Pfkl A G 10: 77,827,204 (GRCm39) V494A possibly damaging Het
Prep G T 10: 44,943,460 (GRCm39) D12Y possibly damaging Het
Prg4 A G 1: 150,328,101 (GRCm39) F188S probably damaging Het
Ripor3 T C 2: 167,839,207 (GRCm39) Y98C probably damaging Het
Rnf216 T A 5: 143,054,069 (GRCm39) probably null Het
Rnf24 A G 2: 131,164,165 (GRCm39) probably benign Het
Rps18-ps6 G A 13: 97,896,901 (GRCm39) R66* probably null Het
Scn3a A G 2: 65,327,742 (GRCm39) M916T probably benign Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sh2b3 C G 5: 121,967,084 (GRCm39) R10P possibly damaging Het
Slc25a27 T C 17: 43,960,585 (GRCm39) D211G probably damaging Het
Slc36a4 A T 9: 15,638,324 (GRCm39) Y250F probably damaging Het
Slc4a1 T A 11: 102,247,351 (GRCm39) E448V probably damaging Het
Slit1 C A 19: 41,731,735 (GRCm39) C38F probably damaging Het
Spock3 T A 8: 63,808,334 (GRCm39) N410K unknown Het
Supt20 G T 3: 54,619,628 (GRCm39) W370L probably benign Het
Tas2r139 T A 6: 42,118,430 (GRCm39) N187K probably damaging Het
Tbc1d9b G A 11: 50,031,311 (GRCm39) V111I probably benign Het
Thsd7b T A 1: 130,138,057 (GRCm39) Y1578* probably null Het
Tln2 T A 9: 67,136,685 (GRCm39) I1267F probably damaging Het
Tnk2 G A 16: 32,490,185 (GRCm39) V363I probably damaging Het
Ttc32 A G 12: 9,085,870 (GRCm39) K139R possibly damaging Het
Vmn1r30 G C 6: 58,412,550 (GRCm39) T94S possibly damaging Het
Vmn1r90 G A 7: 14,295,780 (GRCm39) T106I probably damaging Het
Zfp677 T A 17: 21,618,520 (GRCm39) C526S probably damaging Het
Zfp831 T G 2: 174,485,420 (GRCm39) S32A probably benign Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21,289,649 (GRCm39) missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21,256,317 (GRCm39) missense probably damaging 1.00
IGL01285:Asap2 APN 12 21,279,264 (GRCm39) missense probably damaging 1.00
IGL01318:Asap2 APN 12 21,297,296 (GRCm39) missense probably null 0.00
IGL01355:Asap2 APN 12 21,268,087 (GRCm39) splice site probably benign
IGL01593:Asap2 APN 12 21,263,203 (GRCm39) missense probably null 0.03
IGL01705:Asap2 APN 12 21,299,369 (GRCm39) missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21,304,307 (GRCm39) missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21,315,911 (GRCm39) missense probably damaging 1.00
IGL02876:Asap2 APN 12 21,308,164 (GRCm39) missense probably benign 0.00
IGL02991:Asap2 APN 12 21,299,294 (GRCm39) splice site probably benign
R0157:Asap2 UTSW 12 21,256,326 (GRCm39) missense probably damaging 1.00
R0399:Asap2 UTSW 12 21,267,998 (GRCm39) missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21,263,186 (GRCm39) missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21,297,320 (GRCm39) missense probably damaging 1.00
R0981:Asap2 UTSW 12 21,315,961 (GRCm39) missense probably damaging 0.98
R1141:Asap2 UTSW 12 21,235,111 (GRCm39) missense probably damaging 1.00
R1382:Asap2 UTSW 12 21,315,955 (GRCm39) missense probably damaging 1.00
R1418:Asap2 UTSW 12 21,289,590 (GRCm39) missense probably damaging 1.00
R1418:Asap2 UTSW 12 21,289,586 (GRCm39) missense probably damaging 1.00
R1469:Asap2 UTSW 12 21,263,180 (GRCm39) missense probably benign 0.00
R1469:Asap2 UTSW 12 21,263,180 (GRCm39) missense probably benign 0.00
R1526:Asap2 UTSW 12 21,235,188 (GRCm39) missense probably damaging 1.00
R1542:Asap2 UTSW 12 21,315,998 (GRCm39) missense probably damaging 1.00
R1710:Asap2 UTSW 12 21,274,393 (GRCm39) missense probably damaging 1.00
R1750:Asap2 UTSW 12 21,253,999 (GRCm39) missense probably damaging 1.00
R2151:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2152:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2154:Asap2 UTSW 12 21,162,084 (GRCm39) missense probably damaging 1.00
R2323:Asap2 UTSW 12 21,253,969 (GRCm39) missense probably damaging 1.00
R2378:Asap2 UTSW 12 21,304,319 (GRCm39) missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21,274,378 (GRCm39) missense probably damaging 1.00
R3757:Asap2 UTSW 12 21,317,767 (GRCm39) missense probably damaging 1.00
R4305:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4307:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4308:Asap2 UTSW 12 21,279,482 (GRCm39) missense probably damaging 1.00
R4345:Asap2 UTSW 12 21,280,832 (GRCm39) missense probably damaging 1.00
R4525:Asap2 UTSW 12 21,279,293 (GRCm39) splice site probably null
R4562:Asap2 UTSW 12 21,162,094 (GRCm39) missense probably damaging 1.00
R4999:Asap2 UTSW 12 21,302,766 (GRCm39) missense probably benign 0.19
R5027:Asap2 UTSW 12 21,254,082 (GRCm39) missense probably damaging 1.00
R5221:Asap2 UTSW 12 21,263,191 (GRCm39) missense probably benign 0.14
R5645:Asap2 UTSW 12 21,315,983 (GRCm39) missense probably damaging 0.99
R5799:Asap2 UTSW 12 21,218,247 (GRCm39) missense probably damaging 1.00
R5876:Asap2 UTSW 12 21,262,810 (GRCm39) missense possibly damaging 0.88
R5912:Asap2 UTSW 12 21,256,344 (GRCm39) missense probably damaging 1.00
R6576:Asap2 UTSW 12 21,294,704 (GRCm39) missense probably damaging 1.00
R6896:Asap2 UTSW 12 21,315,526 (GRCm39) missense probably damaging 1.00
R6934:Asap2 UTSW 12 21,218,251 (GRCm39) missense probably damaging 1.00
R7134:Asap2 UTSW 12 21,315,964 (GRCm39) nonsense probably null
R7347:Asap2 UTSW 12 21,279,458 (GRCm39) missense probably benign 0.03
R7378:Asap2 UTSW 12 21,162,052 (GRCm39) missense probably benign 0.01
R7515:Asap2 UTSW 12 21,279,240 (GRCm39) missense possibly damaging 0.76
R8033:Asap2 UTSW 12 21,274,390 (GRCm39) missense probably damaging 1.00
R8793:Asap2 UTSW 12 21,218,212 (GRCm39) missense probably damaging 1.00
R8891:Asap2 UTSW 12 21,162,144 (GRCm39) missense probably damaging 1.00
R8972:Asap2 UTSW 12 21,279,249 (GRCm39) missense probably damaging 1.00
R9021:Asap2 UTSW 12 21,253,999 (GRCm39) missense possibly damaging 0.94
R9216:Asap2 UTSW 12 21,263,191 (GRCm39) missense probably benign 0.14
R9323:Asap2 UTSW 12 21,162,148 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGACTCACAACTTCGCC -3'
(R):5'- GGCAAGGACACAAGTTTCTTAAGG -3'

Sequencing Primer
(F):5'- TACAGCTTACATCAACCTCAGGG -3'
(R):5'- GTTTCTTAAGGGGAAACATTTTGAG -3'
Posted On 2017-12-01