Incidental Mutation 'R5893:Cyp2a4'
ID501624
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26308928 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 165 (G165D)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect probably damaging
Transcript: ENSMUST00000098657
AA Change: G165D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: G165D

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206226
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1215:Cyp2a4 UTSW 7 26314801 missense possibly damaging 0.75
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1374:Cyp2a4 UTSW 7 26312923 missense probably damaging 0.99
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1580:Cyp2a4 UTSW 7 26307651 missense possibly damaging 0.91
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3734:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3741:Cyp2a4 UTSW 7 26308544 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
R7064:Cyp2a4 UTSW 7 26312307 missense probably benign 0.02
R7419:Cyp2a4 UTSW 7 26314763 missense probably benign 0.00
R7562:Cyp2a4 UTSW 7 26312896 missense possibly damaging 0.88
R8231:Cyp2a4 UTSW 7 26312937 missense probably benign 0.00
R8750:Cyp2a4 UTSW 7 26312784 missense probably benign 0.00
Z1176:Cyp2a4 UTSW 7 26307323 nonsense probably null
Z1176:Cyp2a4 UTSW 7 26310841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTCTCAGGACCTACCAAG -3'
(R):5'- AACAGATTACCTGCCCCATGG -3'

Sequencing Primer
(F):5'- CCATACCATGTCCCAGGATAG -3'
(R):5'- ATTACCTGCCCCATGGAGGTAG -3'
Posted On2017-12-01