Incidental Mutation 'R5905:Slc4a11'
ID501639
Institutional Source Beutler Lab
Gene Symbol Slc4a11
Ensembl Gene ENSMUSG00000074796
Gene Namesolute carrier family 4, sodium bicarbonate transporter-like, member 11
Synonyms
MMRRC Submission 044102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R5905 (G1)
Quality Score152
Status Not validated
Chromosome2
Chromosomal Location130684113-130697519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130685052 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 719 (I719F)
Ref Sequence ENSEMBL: ENSMUSP00000096963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000103193]
Predicted Effect probably damaging
Transcript: ENSMUST00000099362
AA Change: I719F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: I719F

DomainStartEndE-ValueType
SCOP:d1a3aa_ 199 276 5e-5 SMART
Pfam:HCO3_cotransp 308 806 9.7e-153 PFAM
transmembrane domain 827 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103193
SMART Domains Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797

DomainStartEndE-ValueType
Pfam:Ham1p_like 10 188 4.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144945
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Als2cl G T 9: 110,898,084 R906L probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arf4 A G 14: 26,653,924 T113A probably benign Het
Arhgap8 A T 15: 84,741,977 K84N possibly damaging Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Catsperb T A 12: 101,602,700 M877K possibly damaging Het
Cc2d2a A T 5: 43,712,426 M890L probably benign Het
Cd180 A T 13: 102,706,033 H529L possibly damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Chd7 C A 4: 8,840,553 N1440K possibly damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dmap1 G T 4: 117,676,766 T132K probably benign Het
Dnah11 C T 12: 117,954,924 G3424E probably damaging Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Egfr A T 11: 16,911,494 E1091V probably damaging Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
F2r A G 13: 95,604,613 V138A possibly damaging Het
Faf1 T A 4: 109,890,929 M477K probably benign Het
Fam149b C T 14: 20,359,910 T235M probably benign Het
Fan1 C A 7: 64,353,651 A808S probably benign Het
Fbxl20 A G 11: 98,115,445 I38T probably damaging Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gm9747 T C 1: 82,234,298 probably benign Het
Grip1 A G 10: 119,985,492 D354G probably benign Het
Grk4 A C 5: 34,711,730 Y189S probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hgfac A G 5: 35,042,362 N63D probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Hrc G A 7: 45,336,234 G270S probably damaging Het
Inhba T A 13: 16,017,308 W5R probably benign Het
Lipm T C 19: 34,111,911 S90P probably benign Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmod3 T A 6: 97,247,614 E415D probably damaging Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marf1 T A 16: 14,127,249 Q1252L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Mepce A G 5: 137,784,720 V448A possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr12 T A 1: 92,620,142 C79S possibly damaging Het
Olfr625-ps1 T A 7: 103,683,574 N285K probably damaging Het
Olfr689 T C 7: 105,314,951 Y316H probably benign Het
Olfr763 A T 10: 129,011,287 M1L probably benign Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Otoa T A 7: 121,094,601 L68Q probably damaging Het
Pclo A T 5: 14,680,385 probably benign Het
Pcsk2 T A 2: 143,749,140 Y186N probably damaging Het
Pigz A G 16: 31,945,428 T435A probably benign Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prss36 T C 7: 127,933,572 D716G probably benign Het
Rapgef5 T A 12: 117,748,426 D547E probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Snrpb T A 2: 130,179,276 probably benign Het
Sox9 A G 11: 112,783,820 E148G probably damaging Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Syt17 T C 7: 118,436,918 D74G probably benign Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Trrap A G 5: 144,849,920 K3170R possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Vmn1r216 C T 13: 23,099,197 L17F probably damaging Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp652 G A 11: 95,749,863 A205T probably benign Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Slc4a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Slc4a11 APN 2 130688138 missense probably benign 0.11
IGL01292:Slc4a11 APN 2 130690832 critical splice donor site probably null
IGL01330:Slc4a11 APN 2 130687682 missense probably benign 0.11
IGL01349:Slc4a11 APN 2 130686943 missense probably benign 0.33
IGL01474:Slc4a11 APN 2 130685544 missense probably damaging 1.00
IGL01528:Slc4a11 APN 2 130685408 unclassified probably benign
IGL01752:Slc4a11 APN 2 130688145 missense probably damaging 1.00
IGL01859:Slc4a11 APN 2 130684994 missense probably damaging 1.00
IGL01914:Slc4a11 APN 2 130687279 missense probably damaging 1.00
IGL02367:Slc4a11 APN 2 130684959 missense probably damaging 1.00
IGL02373:Slc4a11 APN 2 130684898 missense probably benign 0.07
IGL02516:Slc4a11 APN 2 130691393 missense possibly damaging 0.89
IGL02894:Slc4a11 APN 2 130687155 splice site probably null
R0029:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R0077:Slc4a11 UTSW 2 130686301 unclassified probably benign
R0270:Slc4a11 UTSW 2 130690932 missense possibly damaging 0.89
R0502:Slc4a11 UTSW 2 130688157 missense probably damaging 1.00
R1316:Slc4a11 UTSW 2 130686151 missense probably benign 0.01
R1628:Slc4a11 UTSW 2 130687127 intron probably null
R1859:Slc4a11 UTSW 2 130688012 missense probably benign 0.00
R2235:Slc4a11 UTSW 2 130685624 missense probably benign 0.19
R2247:Slc4a11 UTSW 2 130687801 missense probably benign 0.00
R2332:Slc4a11 UTSW 2 130684459 missense probably benign 0.17
R3840:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R3890:Slc4a11 UTSW 2 130685785 missense probably damaging 0.98
R4296:Slc4a11 UTSW 2 130685007 missense probably benign 0.01
R4304:Slc4a11 UTSW 2 130688138 missense probably benign 0.11
R4749:Slc4a11 UTSW 2 130690867 missense probably damaging 1.00
R4927:Slc4a11 UTSW 2 130684946 missense probably damaging 0.99
R4939:Slc4a11 UTSW 2 130684868 missense probably damaging 1.00
R5756:Slc4a11 UTSW 2 130687863 missense probably benign 0.13
R5869:Slc4a11 UTSW 2 130684459 missense probably benign 0.04
R6709:Slc4a11 UTSW 2 130684696 missense probably damaging 1.00
R7337:Slc4a11 UTSW 2 130685532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGTCTGTGGGCAAGAG -3'
(R):5'- TATGAATGGGCCCTAGAGTCC -3'

Sequencing Primer
(F):5'- AACCAGGCCGTCAGGGATG -3'
(R):5'- CCTAGAGTCCCAGGGCAAGAG -3'
Posted On2017-12-01