Mutagenetix > Incidental Mutations

Incidental Mutation 'R5967:Cngb1'

501648

Institutional Source

Beutler Lab

Gene Symbol

Cngb1

Ensembl Gene

ENSMUSG00000031789

Gene Name

cyclic nucleotide gated channel beta 1

Synonyms

BC016201, Cngb1b, Cngb1

MMRRC Submission

043248-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5967 (G1)

Quality Score

128

Status

Not validated

Chromosome

Chromosomal Location

95239045-95306585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95251906 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1068 (K1068R)

Ref Sequence

ENSEMBL: ENSMUSP00000113827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119870] [ENSMUST00000120044] [ENSMUST00000121162]

Predicted Effect

probably damaging
Transcript: ENSMUST00000119870
AA Change: K1068R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: K1068R

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
Pfam:Ion_trans	83	315	9.8e-17	PFAM
cNMP	389	508	4.1e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120044
AA Change: K609R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113750
Gene: ENSMUSG00000031789
AA Change: K609R

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121162
AA Change: K609R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112437
Gene: ENSMUSG00000031789
AA Change: K609R

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
transmembrane domain	79	101	N/A	INTRINSIC
transmembrane domain	114	136	N/A	INTRINSIC
low complexity region	169	182	N/A	INTRINSIC
cNMP	389	508	4e-25	SMART
low complexity region	555	596	N/A	INTRINSIC
low complexity region	599	636	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	A	17: 23,712,358	G192W	probably damaging	Het
Agl	T	A	3: 116,793,708	D66V	probably benign	Het
Agrn	G	A	4: 156,175,103	P792S	probably damaging	Het
AI464131	G	A	4: 41,497,830	A600V	probably benign	Het
Angptl2	A	G	2: 33,228,706	N164S	probably damaging	Het
Birc6	T	C	17: 74,660,439	F4112L	probably damaging	Het
C8b	A	G	4: 104,793,333	E446G	possibly damaging	Het
Ceacam1	C	T	7: 25,474,742	V163I	probably damaging	Het
Gna11	A	G	10: 81,530,809	Y356H	probably benign	Het
Gnl2	A	G	4: 125,041,030	M160V	probably benign	Het
Gpsm1	A	G	2: 26,340,534		probably null	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Kif20a	G	T	18: 34,630,527	R609L	probably benign	Het
Meis2	G	A	2: 115,864,309	T444I	probably benign	Het
Muc3	T	A	5: 137,146,637	I62L	probably benign	Het
Ncor2	C	T	5: 125,068,984	D526N	unknown	Het
Nodal	G	T	10: 61,423,667	E294D	probably damaging	Het
Nup214	T	C	2: 31,979,778	V161A	possibly damaging	Het
Olfr1029	G	A	2: 85,976,191	R316H	probably benign	Het
Olfr172	G	T	16: 58,760,362	D271E	probably damaging	Het
Olfr514	C	T	7: 108,825,714	G95D	probably benign	Het
Pclo	A	T	5: 14,540,655	T990S	unknown	Het
Piwil2	A	T	14: 70,390,564	M752K	probably benign	Het
Ppargc1b	A	G	18: 61,298,766	S1004P	probably damaging	Het
Prkd1	A	T	12: 50,364,550	M805K	probably damaging	Het
Rad23a	T	C	8: 84,838,939	E30G	probably damaging	Het
Ralbp1	A	G	17: 65,864,279	V233A	probably benign	Het
Scin	C	T	12: 40,077,538	E418K	probably benign	Het
Scn7a	T	A	2: 66,675,713	I1611F	probably damaging	Het
Slit2	A	T	5: 47,985,164	H42L	probably damaging	Het
Stard9	T	A	2: 120,706,894	V4259D	probably damaging	Het
Trhde	T	A	10: 114,567,134	Y528F	probably damaging	Het
Txlnb	A	G	10: 17,799,420	E107G	probably damaging	Het
Zfp715	T	C	7: 43,299,148	T463A	probably benign	Het

Other mutations in Cngb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cngb1	APN	8	95242184	splice site	probably benign
IGL01575:Cngb1	APN	8	95264520	missense	possibly damaging	0.51
IGL02329:Cngb1	APN	8	95242359	missense	probably benign	0.14
IGL03332:Cngb1	APN	8	95298846	splice site	probably benign
IGL03391:Cngb1	APN	8	95303705	unclassified	probably benign
stevie	UTSW	8	95260130	missense	probably damaging	1.00
R0078:Cngb1	UTSW	8	95264545	critical splice acceptor site	probably null
R0116:Cngb1	UTSW	8	95260638	missense	probably damaging	1.00
R1073:Cngb1	UTSW	8	95303567	critical splice donor site	probably null
R1166:Cngb1	UTSW	8	95260181	missense	probably damaging	0.99
R1714:Cngb1	UTSW	8	95257931	missense	probably damaging	1.00
R1753:Cngb1	UTSW	8	95297773	critical splice donor site	probably benign
R1760:Cngb1	UTSW	8	95299700	missense	probably benign	0.03
R1833:Cngb1	UTSW	8	95242355	missense	probably damaging	1.00
R1935:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R1939:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R1940:Cngb1	UTSW	8	95299692	missense	probably damaging	1.00
R2045:Cngb1	UTSW	8	95297085	splice site	probably null
R2379:Cngb1	UTSW	8	95260130	missense	probably damaging	1.00
R2940:Cngb1	UTSW	8	95252107	missense	probably benign	0.44
R4034:Cngb1	UTSW	8	95264450	missense	possibly damaging	0.47
R4058:Cngb1	UTSW	8	95267654	missense	probably benign	0.00
R4425:Cngb1	UTSW	8	95299716	missense	probably damaging	1.00
R4585:Cngb1	UTSW	8	95297128	critical splice acceptor site	probably null
R4591:Cngb1	UTSW	8	95253384	missense	probably damaging	1.00
R4638:Cngb1	UTSW	8	95266019	missense	probably damaging	1.00
R4906:Cngb1	UTSW	8	95251973	missense	probably damaging	0.96
R4950:Cngb1	UTSW	8	95248507	missense	probably damaging	1.00
R4979:Cngb1	UTSW	8	95259157	missense	probably damaging	0.99
R5148:Cngb1	UTSW	8	95265983	missense	probably benign	0.28
R5474:Cngb1	UTSW	8	95251969	missense	probably damaging	1.00
R5475:Cngb1	UTSW	8	95251969	missense	probably damaging	1.00
R5545:Cngb1	UTSW	8	95252173	missense
R5585:Cngb1	UTSW	8	95263139	missense	probably damaging	1.00
R5637:Cngb1	UTSW	8	95257921	missense	probably damaging	1.00
R5785:Cngb1	UTSW	8	95254195	missense	possibly damaging	0.90
R6013:Cngb1	UTSW	8	95284321	unclassified	probably benign
R6049:Cngb1	UTSW	8	95270842	missense	probably damaging	0.99
R6370:Cngb1	UTSW	8	95264422	missense	probably benign	0.33
R6377:Cngb1	UTSW	8	95248980	missense	probably damaging	1.00
R6401:Cngb1	UTSW	8	95303739	unclassified	probably benign
R6427:Cngb1	UTSW	8	95297759	intron	probably benign
R6492:Cngb1	UTSW	8	95264424	missense	probably benign	0.01
R6613:Cngb1	UTSW	8	95266010	missense	possibly damaging	0.95
R6721:Cngb1	UTSW	8	95270888	missense	probably benign	0.05
R6919:Cngb1	UTSW	8	95248375	missense	probably null	1.00
R7012:Cngb1	UTSW	8	95257955	missense	possibly damaging	0.83
R7418:Cngb1	UTSW	8	95278259	nonsense	probably null
R7464:Cngb1	UTSW	8	95254183	missense	possibly damaging	0.92
R7806:Cngb1	UTSW	8	95298804	critical splice donor site	probably null
R8048:Cngb1	UTSW	8	95263210	missense	possibly damaging	0.90
R8074:Cngb1	UTSW	8	95252173	missense
R8189:Cngb1	UTSW	8	95303620	unclassified	probably benign
R8245:Cngb1	UTSW	8	95297780	missense	unknown
R8286:Cngb1	UTSW	8	95275624	missense
RF010:Cngb1	UTSW	8	95303650	frame shift	probably null
RF053:Cngb1	UTSW	8	95303648	frame shift	probably null
T0722:Cngb1	UTSW	8	95296650	missense	probably benign	0.02
T0722:Cngb1	UTSW	8	95297819	missense	probably damaging	0.99
T0722:Cngb1	UTSW	8	95303696	unclassified	probably benign
T0722:Cngb1	UTSW	8	95303714	unclassified	probably benign
Z1177:Cngb1	UTSW	8	95252136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAATGAGACCCTGGCAGC -3'
(R):5'- AGTATTGTCAGCAAAGTGGCC -3'

Sequencing Primer
(F):5'- AGACCCTGGCAGCAGGTTTG -3'
(R):5'- AGCAAAGTGGCCCTCTTTCAG -3'

Posted On

2017-12-01