Incidental Mutation 'R5967:Cngb1'
ID501648
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Namecyclic nucleotide gated channel beta 1
SynonymsBC016201, Cngb1b, Cngb1
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5967 (G1)
Quality Score128
Status Not validated
Chromosome8
Chromosomal Location95239045-95306585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95251906 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1068 (K1068R)
Ref Sequence ENSEMBL: ENSMUSP00000113827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119870] [ENSMUST00000120044] [ENSMUST00000121162]
Predicted Effect probably damaging
Transcript: ENSMUST00000119870
AA Change: K1068R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: K1068R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120044
AA Change: K609R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113750
Gene: ENSMUSG00000031789
AA Change: K609R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121162
AA Change: K609R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112437
Gene: ENSMUSG00000031789
AA Change: K609R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95242184 splice site probably benign
IGL01575:Cngb1 APN 8 95264520 missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95242359 missense probably benign 0.14
IGL03332:Cngb1 APN 8 95298846 splice site probably benign
IGL03391:Cngb1 APN 8 95303705 unclassified probably benign
stevie UTSW 8 95260130 missense probably damaging 1.00
R0078:Cngb1 UTSW 8 95264545 critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95260638 missense probably damaging 1.00
R1073:Cngb1 UTSW 8 95303567 critical splice donor site probably null
R1166:Cngb1 UTSW 8 95260181 missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95257931 missense probably damaging 1.00
R1753:Cngb1 UTSW 8 95297773 critical splice donor site probably benign
R1760:Cngb1 UTSW 8 95299700 missense probably benign 0.03
R1833:Cngb1 UTSW 8 95242355 missense probably damaging 1.00
R1935:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1939:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1940:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R2045:Cngb1 UTSW 8 95297085 splice site probably null
R2379:Cngb1 UTSW 8 95260130 missense probably damaging 1.00
R2940:Cngb1 UTSW 8 95252107 missense probably benign 0.44
R4034:Cngb1 UTSW 8 95264450 missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95267654 missense probably benign 0.00
R4425:Cngb1 UTSW 8 95299716 missense probably damaging 1.00
R4585:Cngb1 UTSW 8 95297128 critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95253384 missense probably damaging 1.00
R4638:Cngb1 UTSW 8 95266019 missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95251973 missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95248507 missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95259157 missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95265983 missense probably benign 0.28
R5474:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95252173 missense
R5585:Cngb1 UTSW 8 95263139 missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95257921 missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95254195 missense possibly damaging 0.90
R6013:Cngb1 UTSW 8 95284321 unclassified probably benign
R6049:Cngb1 UTSW 8 95270842 missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95264422 missense probably benign 0.33
R6377:Cngb1 UTSW 8 95248980 missense probably damaging 1.00
R6401:Cngb1 UTSW 8 95303739 unclassified probably benign
R6427:Cngb1 UTSW 8 95297759 intron probably benign
R6492:Cngb1 UTSW 8 95264424 missense probably benign 0.01
R6613:Cngb1 UTSW 8 95266010 missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95270888 missense probably benign 0.05
R6919:Cngb1 UTSW 8 95248375 missense probably null 1.00
R7012:Cngb1 UTSW 8 95257955 missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 95278259 nonsense probably null
R7464:Cngb1 UTSW 8 95254183 missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 95298804 critical splice donor site probably null
R8048:Cngb1 UTSW 8 95263210 missense possibly damaging 0.90
R8074:Cngb1 UTSW 8 95252173 missense
R8189:Cngb1 UTSW 8 95303620 unclassified probably benign
R8245:Cngb1 UTSW 8 95297780 missense unknown
R8286:Cngb1 UTSW 8 95275624 missense
RF010:Cngb1 UTSW 8 95303650 frame shift probably null
RF053:Cngb1 UTSW 8 95303648 frame shift probably null
T0722:Cngb1 UTSW 8 95296650 missense probably benign 0.02
T0722:Cngb1 UTSW 8 95297819 missense probably damaging 0.99
T0722:Cngb1 UTSW 8 95303696 unclassified probably benign
T0722:Cngb1 UTSW 8 95303714 unclassified probably benign
Z1177:Cngb1 UTSW 8 95252136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATGAGACCCTGGCAGC -3'
(R):5'- AGTATTGTCAGCAAAGTGGCC -3'

Sequencing Primer
(F):5'- AGACCCTGGCAGCAGGTTTG -3'
(R):5'- AGCAAAGTGGCCCTCTTTCAG -3'
Posted On2017-12-01