Incidental Mutation 'R5970:Duox1'
ID 501653
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms NOXEF1, LNOX1, 9930101G15Rik, THOX1
MMRRC Submission 044153-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122146153-122178453 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122170682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1234 (L1234Q)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
AlphaFold A2AQ92
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: L1234Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: L1234Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Meta Mutation Damage Score 0.8438 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,574,028 (GRCm39) probably benign Het
Ambn T C 5: 88,615,810 (GRCm39) V413A possibly damaging Het
Amotl1 T A 9: 14,507,824 (GRCm39) D41V probably damaging Het
Arhgef26 T C 3: 62,247,468 (GRCm39) V184A probably benign Het
Birc6 G T 17: 74,925,497 (GRCm39) G936V possibly damaging Het
Ccser1 T A 6: 61,288,226 (GRCm39) S130T possibly damaging Het
Cecr2 A G 6: 120,697,868 (GRCm39) I56V probably damaging Het
Cfap52 A G 11: 67,821,570 (GRCm39) I486T probably damaging Het
Col4a3 A G 1: 82,694,050 (GRCm39) I1557V possibly damaging Het
Col6a5 T A 9: 105,823,046 (GRCm39) I104F unknown Het
Cry2 A G 2: 92,243,312 (GRCm39) S510P probably benign Het
Csmd2 G C 4: 128,439,944 (GRCm39) A3133P probably benign Het
Cyld G T 8: 89,459,621 (GRCm39) A611S probably damaging Het
Dennd4c G A 4: 86,743,749 (GRCm39) G1197E probably damaging Het
Dnah10 T C 5: 124,885,793 (GRCm39) F2969L probably benign Het
Dnai1 A G 4: 41,625,281 (GRCm39) K415R probably benign Het
Dnmbp T A 19: 43,842,610 (GRCm39) T1253S probably benign Het
Dsp T C 13: 38,379,678 (GRCm39) L1542P possibly damaging Het
Efr3b T A 12: 4,018,590 (GRCm39) R585S possibly damaging Het
Gpt A G 15: 76,583,552 (GRCm39) probably null Het
Heatr6 G A 11: 83,644,544 (GRCm39) probably benign Het
Kcns2 A G 15: 34,839,930 (GRCm39) D431G probably benign Het
Kdm3b A G 18: 34,962,342 (GRCm39) N1543D probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mical3 G A 6: 120,935,232 (GRCm39) Q893* probably null Het
Morc3 C T 16: 93,663,341 (GRCm39) H515Y possibly damaging Het
Mprip A T 11: 59,648,547 (GRCm39) R750S probably damaging Het
Mroh1 G A 15: 76,335,691 (GRCm39) V1436M probably benign Het
Muc5ac C T 7: 141,344,406 (GRCm39) R69* probably null Het
Muc5b A T 7: 141,410,449 (GRCm39) Y1274F unknown Het
Mybpc1 A G 10: 88,378,318 (GRCm39) L674P probably damaging Het
Mypn A G 10: 62,966,802 (GRCm39) V958A probably benign Het
Nipbl T C 15: 8,326,302 (GRCm39) T2436A probably benign Het
Or7g20 A G 9: 18,946,443 (GRCm39) D8G probably benign Het
Pcdhb5 T A 18: 37,454,826 (GRCm39) L402Q probably damaging Het
Pigp T A 16: 94,171,053 (GRCm39) probably null Het
Rp1 A G 1: 4,418,685 (GRCm39) L809P probably benign Het
Scn3a T A 2: 65,325,125 (GRCm39) probably benign Het
Sdf2 A T 11: 78,136,906 (GRCm39) M29L probably benign Het
Serpina3b T G 12: 104,100,350 (GRCm39) L311V possibly damaging Het
Snx31 A T 15: 36,523,634 (GRCm39) Y349* probably null Het
Spidr A C 16: 15,932,733 (GRCm39) C182W probably damaging Het
St13 A T 15: 81,261,999 (GRCm39) S146R probably damaging Het
St8sia4 A G 1: 95,581,307 (GRCm39) V145A probably damaging Het
Stradb T C 1: 59,019,175 (GRCm39) probably null Het
Tcp11l2 T A 10: 84,430,661 (GRCm39) probably benign Het
Tfdp2 C T 9: 96,199,627 (GRCm39) P74S unknown Het
Tmprss15 C T 16: 78,854,547 (GRCm39) R287H probably benign Het
Trav10d T C 14: 53,048,779 (GRCm39) Y57H probably damaging Het
Vmn2r104 A G 17: 20,249,733 (GRCm39) I846T probably benign Het
Ywhah T A 5: 33,184,292 (GRCm39) M165K possibly damaging Het
Zfp324 C A 7: 12,703,293 (GRCm39) P72T probably benign Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122,163,622 (GRCm39) missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122,153,787 (GRCm39) missense probably benign 0.42
IGL01413:Duox1 APN 2 122,151,191 (GRCm39) missense probably benign 0.03
IGL01444:Duox1 APN 2 122,170,571 (GRCm39) missense probably damaging 0.98
IGL01633:Duox1 APN 2 122,164,279 (GRCm39) missense probably benign 0.00
IGL01814:Duox1 APN 2 122,176,753 (GRCm39) missense probably damaging 0.99
IGL01868:Duox1 APN 2 122,168,888 (GRCm39) missense probably benign
IGL02096:Duox1 APN 2 122,174,655 (GRCm39) missense probably damaging 0.99
IGL02126:Duox1 APN 2 122,176,817 (GRCm39) missense probably benign 0.21
IGL02342:Duox1 APN 2 122,177,793 (GRCm39) missense probably damaging 1.00
IGL02687:Duox1 APN 2 122,166,896 (GRCm39) missense probably damaging 1.00
IGL02708:Duox1 APN 2 122,156,498 (GRCm39) missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122,155,000 (GRCm39) missense possibly damaging 0.56
antiquity UTSW 2 122,170,682 (GRCm39) missense probably damaging 1.00
Dejavous UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R5032_duox1_732 UTSW 2 122,167,798 (GRCm39) missense probably benign
Vaguely UTSW 2 122,156,616 (GRCm39) nonsense probably null
D4043:Duox1 UTSW 2 122,175,276 (GRCm39) missense probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0241:Duox1 UTSW 2 122,163,878 (GRCm39) splice site probably benign
R0479:Duox1 UTSW 2 122,176,861 (GRCm39) missense probably damaging 1.00
R0834:Duox1 UTSW 2 122,176,982 (GRCm39) missense probably damaging 1.00
R1105:Duox1 UTSW 2 122,168,183 (GRCm39) missense probably damaging 0.97
R1205:Duox1 UTSW 2 122,158,406 (GRCm39) nonsense probably null
R1281:Duox1 UTSW 2 122,157,569 (GRCm39) missense probably damaging 1.00
R1302:Duox1 UTSW 2 122,177,760 (GRCm39) missense probably benign 0.24
R1532:Duox1 UTSW 2 122,175,204 (GRCm39) missense probably damaging 1.00
R1706:Duox1 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R1719:Duox1 UTSW 2 122,169,125 (GRCm39) missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122,163,910 (GRCm39) missense probably damaging 1.00
R1827:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1828:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1940:Duox1 UTSW 2 122,156,465 (GRCm39) missense probably benign 0.06
R1944:Duox1 UTSW 2 122,177,001 (GRCm39) missense probably damaging 0.99
R2069:Duox1 UTSW 2 122,163,543 (GRCm39) missense probably benign
R2113:Duox1 UTSW 2 122,167,735 (GRCm39) missense probably benign
R2202:Duox1 UTSW 2 122,175,194 (GRCm39) missense probably benign 0.19
R2314:Duox1 UTSW 2 122,164,211 (GRCm39) nonsense probably null
R2507:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R2508:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R3177:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R3277:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R4124:Duox1 UTSW 2 122,167,902 (GRCm39) missense probably damaging 1.00
R4271:Duox1 UTSW 2 122,154,856 (GRCm39) missense probably damaging 0.96
R4411:Duox1 UTSW 2 122,168,115 (GRCm39) missense probably benign 0.30
R4419:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4420:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4578:Duox1 UTSW 2 122,164,258 (GRCm39) missense probably benign 0.15
R4628:Duox1 UTSW 2 122,176,733 (GRCm39) missense probably damaging 1.00
R4665:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4666:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4730:Duox1 UTSW 2 122,164,312 (GRCm39) missense probably damaging 1.00
R4767:Duox1 UTSW 2 122,163,922 (GRCm39) missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122,146,212 (GRCm39) missense probably benign 0.05
R4904:Duox1 UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R5032:Duox1 UTSW 2 122,167,798 (GRCm39) missense probably benign
R5201:Duox1 UTSW 2 122,158,403 (GRCm39) missense probably benign
R5474:Duox1 UTSW 2 122,177,106 (GRCm39) missense probably benign 0.02
R5835:Duox1 UTSW 2 122,158,341 (GRCm39) missense probably benign 0.00
R5939:Duox1 UTSW 2 122,176,832 (GRCm39) missense probably damaging 1.00
R5941:Duox1 UTSW 2 122,174,637 (GRCm39) missense probably damaging 0.97
R5943:Duox1 UTSW 2 122,163,916 (GRCm39) missense probably benign 0.00
R6023:Duox1 UTSW 2 122,168,165 (GRCm39) missense probably benign 0.19
R6050:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R6064:Duox1 UTSW 2 122,151,243 (GRCm39) missense probably benign 0.00
R6093:Duox1 UTSW 2 122,177,755 (GRCm39) missense probably benign 0.01
R6188:Duox1 UTSW 2 122,150,275 (GRCm39) missense probably benign 0.00
R6246:Duox1 UTSW 2 122,157,655 (GRCm39) missense probably damaging 1.00
R6259:Duox1 UTSW 2 122,175,264 (GRCm39) missense probably benign 0.00
R6290:Duox1 UTSW 2 122,164,288 (GRCm39) missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122,168,181 (GRCm39) missense probably damaging 0.99
R6341:Duox1 UTSW 2 122,168,202 (GRCm39) missense probably damaging 0.98
R6498:Duox1 UTSW 2 122,150,088 (GRCm39) missense probably damaging 1.00
R6883:Duox1 UTSW 2 122,155,065 (GRCm39) splice site probably null
R7002:Duox1 UTSW 2 122,150,358 (GRCm39) nonsense probably null
R7410:Duox1 UTSW 2 122,176,874 (GRCm39) missense probably damaging 1.00
R7421:Duox1 UTSW 2 122,153,711 (GRCm39) missense probably damaging 1.00
R7608:Duox1 UTSW 2 122,156,616 (GRCm39) nonsense probably null
R7702:Duox1 UTSW 2 122,160,120 (GRCm39) missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122,167,782 (GRCm39) missense probably benign
R7833:Duox1 UTSW 2 122,154,869 (GRCm39) missense probably damaging 1.00
R7980:Duox1 UTSW 2 122,177,801 (GRCm39) missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122,175,249 (GRCm39) missense probably benign 0.02
R8717:Duox1 UTSW 2 122,168,152 (GRCm39) missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122,175,186 (GRCm39) missense probably damaging 1.00
R9196:Duox1 UTSW 2 122,150,689 (GRCm39) missense probably benign 0.08
R9344:Duox1 UTSW 2 122,168,163 (GRCm39) missense probably benign 0.14
R9397:Duox1 UTSW 2 122,150,783 (GRCm39) missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122,156,907 (GRCm39) missense probably benign 0.01
R9510:Duox1 UTSW 2 122,160,023 (GRCm39) missense possibly damaging 0.92
R9521:Duox1 UTSW 2 122,159,216 (GRCm39) missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9565:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9569:Duox1 UTSW 2 122,148,971 (GRCm39) missense probably benign
Z1176:Duox1 UTSW 2 122,163,519 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGACATGGCTGAATACCC -3'
(R):5'- TCCAAGAGCCGCATAATGGG -3'

Sequencing Primer
(F):5'- TGGCTGAATACCCCAGGAC -3'
(R):5'- CGCATAATGGGGTCAACCTACTG -3'
Posted On 2017-12-01