Incidental Mutation 'R5970:Zfp324'
ID 501656
Institutional Source Beutler Lab
Gene Symbol Zfp324
Ensembl Gene ENSMUSG00000004500
Gene Name zinc finger protein 324
Synonyms D430030K24Rik, ZF5128
MMRRC Submission 044153-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 12699765-12707749 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12703293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 72 (P72T)
Ref Sequence ENSEMBL: ENSMUSP00000041944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000124387] [ENSMUST00000128293] [ENSMUST00000210619]
AlphaFold Q78F42
Predicted Effect probably benign
Transcript: ENSMUST00000038701
AA Change: P72T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500
AA Change: P72T

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124387
AA Change: D29E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210619
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,574,028 (GRCm39) probably benign Het
Ambn T C 5: 88,615,810 (GRCm39) V413A possibly damaging Het
Amotl1 T A 9: 14,507,824 (GRCm39) D41V probably damaging Het
Arhgef26 T C 3: 62,247,468 (GRCm39) V184A probably benign Het
Birc6 G T 17: 74,925,497 (GRCm39) G936V possibly damaging Het
Ccser1 T A 6: 61,288,226 (GRCm39) S130T possibly damaging Het
Cecr2 A G 6: 120,697,868 (GRCm39) I56V probably damaging Het
Cfap52 A G 11: 67,821,570 (GRCm39) I486T probably damaging Het
Col4a3 A G 1: 82,694,050 (GRCm39) I1557V possibly damaging Het
Col6a5 T A 9: 105,823,046 (GRCm39) I104F unknown Het
Cry2 A G 2: 92,243,312 (GRCm39) S510P probably benign Het
Csmd2 G C 4: 128,439,944 (GRCm39) A3133P probably benign Het
Cyld G T 8: 89,459,621 (GRCm39) A611S probably damaging Het
Dennd4c G A 4: 86,743,749 (GRCm39) G1197E probably damaging Het
Dnah10 T C 5: 124,885,793 (GRCm39) F2969L probably benign Het
Dnai1 A G 4: 41,625,281 (GRCm39) K415R probably benign Het
Dnmbp T A 19: 43,842,610 (GRCm39) T1253S probably benign Het
Dsp T C 13: 38,379,678 (GRCm39) L1542P possibly damaging Het
Duox1 T A 2: 122,170,682 (GRCm39) L1234Q probably damaging Het
Efr3b T A 12: 4,018,590 (GRCm39) R585S possibly damaging Het
Gpt A G 15: 76,583,552 (GRCm39) probably null Het
Heatr6 G A 11: 83,644,544 (GRCm39) probably benign Het
Kcns2 A G 15: 34,839,930 (GRCm39) D431G probably benign Het
Kdm3b A G 18: 34,962,342 (GRCm39) N1543D probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mical3 G A 6: 120,935,232 (GRCm39) Q893* probably null Het
Morc3 C T 16: 93,663,341 (GRCm39) H515Y possibly damaging Het
Mprip A T 11: 59,648,547 (GRCm39) R750S probably damaging Het
Mroh1 G A 15: 76,335,691 (GRCm39) V1436M probably benign Het
Muc5ac C T 7: 141,344,406 (GRCm39) R69* probably null Het
Muc5b A T 7: 141,410,449 (GRCm39) Y1274F unknown Het
Mybpc1 A G 10: 88,378,318 (GRCm39) L674P probably damaging Het
Mypn A G 10: 62,966,802 (GRCm39) V958A probably benign Het
Nipbl T C 15: 8,326,302 (GRCm39) T2436A probably benign Het
Or7g20 A G 9: 18,946,443 (GRCm39) D8G probably benign Het
Pcdhb5 T A 18: 37,454,826 (GRCm39) L402Q probably damaging Het
Pigp T A 16: 94,171,053 (GRCm39) probably null Het
Rp1 A G 1: 4,418,685 (GRCm39) L809P probably benign Het
Scn3a T A 2: 65,325,125 (GRCm39) probably benign Het
Sdf2 A T 11: 78,136,906 (GRCm39) M29L probably benign Het
Serpina3b T G 12: 104,100,350 (GRCm39) L311V possibly damaging Het
Snx31 A T 15: 36,523,634 (GRCm39) Y349* probably null Het
Spidr A C 16: 15,932,733 (GRCm39) C182W probably damaging Het
St13 A T 15: 81,261,999 (GRCm39) S146R probably damaging Het
St8sia4 A G 1: 95,581,307 (GRCm39) V145A probably damaging Het
Stradb T C 1: 59,019,175 (GRCm39) probably null Het
Tcp11l2 T A 10: 84,430,661 (GRCm39) probably benign Het
Tfdp2 C T 9: 96,199,627 (GRCm39) P74S unknown Het
Tmprss15 C T 16: 78,854,547 (GRCm39) R287H probably benign Het
Trav10d T C 14: 53,048,779 (GRCm39) Y57H probably damaging Het
Vmn2r104 A G 17: 20,249,733 (GRCm39) I846T probably benign Het
Ywhah T A 5: 33,184,292 (GRCm39) M165K possibly damaging Het
Other mutations in Zfp324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Zfp324 APN 7 12,703,362 (GRCm39) missense probably benign 0.02
IGL01943:Zfp324 APN 7 12,702,713 (GRCm39) splice site probably benign
IGL02668:Zfp324 APN 7 12,704,773 (GRCm39) missense probably damaging 1.00
R0883:Zfp324 UTSW 7 12,704,951 (GRCm39) missense probably damaging 1.00
R0931:Zfp324 UTSW 7 12,700,185 (GRCm39) missense probably benign 0.05
R1164:Zfp324 UTSW 7 12,705,551 (GRCm39) missense probably benign 0.02
R1587:Zfp324 UTSW 7 12,704,570 (GRCm39) missense possibly damaging 0.63
R1837:Zfp324 UTSW 7 12,704,156 (GRCm39) missense probably benign 0.15
R1982:Zfp324 UTSW 7 12,705,145 (GRCm39) missense probably damaging 1.00
R2333:Zfp324 UTSW 7 12,705,172 (GRCm39) missense possibly damaging 0.93
R3155:Zfp324 UTSW 7 12,702,817 (GRCm39) missense probably damaging 1.00
R4050:Zfp324 UTSW 7 12,704,794 (GRCm39) missense probably damaging 1.00
R4784:Zfp324 UTSW 7 12,705,233 (GRCm39) missense probably damaging 1.00
R4992:Zfp324 UTSW 7 12,703,300 (GRCm39) missense probably benign 0.02
R6767:Zfp324 UTSW 7 12,704,527 (GRCm39) missense probably null 0.13
R7007:Zfp324 UTSW 7 12,705,142 (GRCm39) missense probably damaging 1.00
R7152:Zfp324 UTSW 7 12,700,198 (GRCm39) missense probably benign 0.07
R7164:Zfp324 UTSW 7 12,702,810 (GRCm39) missense probably damaging 0.97
R7233:Zfp324 UTSW 7 12,704,524 (GRCm39) nonsense probably null
R9039:Zfp324 UTSW 7 12,705,455 (GRCm39) missense probably benign 0.19
R9172:Zfp324 UTSW 7 12,704,689 (GRCm39) missense probably damaging 1.00
X0062:Zfp324 UTSW 7 12,705,316 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTGGCTGTCTACATTC -3'
(R):5'- TAGAGAATGTAGTAGCCCTTGCC -3'

Sequencing Primer
(F):5'- AGCACCTTCCTTTGGAGTGGC -3'
(R):5'- GTAGTAGCCCTTGCCCCTGAATAC -3'
Posted On 2017-12-01