Incidental Mutation 'R5970:St13'
ID501659
Institutional Source Beutler Lab
Gene Symbol St13
Ensembl Gene ENSMUSG00000022403
Gene Namesuppression of tumorigenicity 13
SynonymsHsp70 interacting protein, HSPABP1, PRO0786, 1110007I03Rik, 3110002K08Rik, SNC6, p48
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81363669-81400077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81377798 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 146 (S146R)
Ref Sequence ENSEMBL: ENSMUSP00000023039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000165582] [ENSMUST00000172107]
Predicted Effect probably damaging
Transcript: ENSMUST00000023039
AA Change: S146R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403
AA Change: S146R

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165582
AA Change: S118R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129966
Gene: ENSMUSG00000022403
AA Change: S118R

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
Pfam:TPR_11 74 129 6.8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172107
AA Change: S155R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403
AA Change: S155R

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Meta Mutation Damage Score 0.7363 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in St13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:St13 APN 15 81371507 missense probably damaging 0.99
IGL01933:St13 APN 15 81389698 critical splice acceptor site probably null
IGL02152:St13 APN 15 81366382 missense probably damaging 1.00
R0714:St13 UTSW 15 81383027 missense probably benign 0.16
R3417:St13 UTSW 15 81369450 splice site probably benign
R4845:St13 UTSW 15 81399585 missense probably benign 0.09
R4925:St13 UTSW 15 81399585 missense probably benign 0.09
R4934:St13 UTSW 15 81399585 missense probably benign 0.09
R5029:St13 UTSW 15 81399585 missense probably benign 0.09
R5042:St13 UTSW 15 81365492 missense probably damaging 1.00
R5048:St13 UTSW 15 81399585 missense probably benign 0.09
R5139:St13 UTSW 15 81399585 missense probably benign 0.09
R6158:St13 UTSW 15 81399601 unclassified probably null
R6175:St13 UTSW 15 81399305 critical splice donor site probably null
R6872:St13 UTSW 15 81366346 critical splice donor site probably null
R7320:St13 UTSW 15 81389653 missense probably damaging 0.99
R7912:St13 UTSW 15 81399518 missense possibly damaging 0.52
R7993:St13 UTSW 15 81399518 missense possibly damaging 0.52
X0065:St13 UTSW 15 81366436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTAGCCTCCATAGCACCACG -3'
(R):5'- TGTTCACAGACGCCATCAAG -3'

Sequencing Primer
(F):5'- AAGGTGTGTGCCATCACTAC -3'
(R):5'- ACTGGAGCACAAAGTCCT -3'
Posted On2017-12-01