Incidental Mutation 'R5907:Dnpep'
ID 501675
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Name aspartyl aminopeptidase
Synonyms
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75285209-75294298 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 75288635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187075] [ENSMUST00000187836] [ENSMUST00000191254] [ENSMUST00000189282] [ENSMUST00000189551] [ENSMUST00000188652]
AlphaFold Q9Z2W0
Predicted Effect probably null
Transcript: ENSMUST00000066668
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113605
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185419
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185797
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186278
Predicted Effect probably benign
Transcript: ENSMUST00000187000
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187075
SMART Domains Protein: ENSMUSP00000140877
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 222 1.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187791
Predicted Effect probably null
Transcript: ENSMUST00000187836
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191254
SMART Domains Protein: ENSMUSP00000140997
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 64 8.8e-11 PFAM
Pfam:Peptidase_M18 60 92 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189282
SMART Domains Protein: ENSMUSP00000141187
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 57 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189551
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190005
Predicted Effect probably benign
Transcript: ENSMUST00000188652
SMART Domains Protein: ENSMUSP00000139532
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 85 4.4e-22 PFAM
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75,292,332 (GRCm39) missense probably damaging 1.00
P0026:Dnpep UTSW 1 75,285,329 (GRCm39) missense probably benign 0.01
R0126:Dnpep UTSW 1 75,289,182 (GRCm39) nonsense probably null
R0318:Dnpep UTSW 1 75,293,270 (GRCm39) missense probably damaging 1.00
R0669:Dnpep UTSW 1 75,288,422 (GRCm39) unclassified probably benign
R1076:Dnpep UTSW 1 75,292,582 (GRCm39) unclassified probably benign
R1478:Dnpep UTSW 1 75,292,671 (GRCm39) missense probably damaging 1.00
R1803:Dnpep UTSW 1 75,286,058 (GRCm39) nonsense probably null
R3409:Dnpep UTSW 1 75,293,270 (GRCm39) missense probably damaging 1.00
R3411:Dnpep UTSW 1 75,293,270 (GRCm39) missense probably damaging 1.00
R4590:Dnpep UTSW 1 75,293,045 (GRCm39) missense probably damaging 1.00
R4863:Dnpep UTSW 1 75,285,874 (GRCm39) intron probably benign
R4948:Dnpep UTSW 1 75,293,404 (GRCm39) missense probably benign 0.13
R5873:Dnpep UTSW 1 75,291,787 (GRCm39) missense probably damaging 1.00
R5891:Dnpep UTSW 1 75,288,456 (GRCm39) missense probably benign
R6143:Dnpep UTSW 1 75,291,872 (GRCm39) missense probably damaging 1.00
R6432:Dnpep UTSW 1 75,292,022 (GRCm39) missense probably benign 0.12
R6433:Dnpep UTSW 1 75,292,022 (GRCm39) missense probably benign 0.12
R7188:Dnpep UTSW 1 75,292,701 (GRCm39) missense probably damaging 1.00
R7189:Dnpep UTSW 1 75,290,074 (GRCm39) missense probably damaging 1.00
R7620:Dnpep UTSW 1 75,290,092 (GRCm39) missense probably benign 0.02
R7682:Dnpep UTSW 1 75,293,384 (GRCm39) missense probably damaging 1.00
R7770:Dnpep UTSW 1 75,293,890 (GRCm39) intron probably benign
R8214:Dnpep UTSW 1 75,292,642 (GRCm39) missense probably damaging 1.00
R9051:Dnpep UTSW 1 75,292,329 (GRCm39) missense probably damaging 1.00
R9055:Dnpep UTSW 1 75,291,805 (GRCm39) missense possibly damaging 0.70
R9081:Dnpep UTSW 1 75,291,060 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCACCTCTCGAATCATGG -3'
(R):5'- AAGCTTTGTCTGTGACCTTGC -3'

Sequencing Primer
(F):5'- TGGACTCAGACACTGCATTAG -3'
(R):5'- CATGGCTAGAATCTGCCTGAATCG -3'
Posted On 2017-12-01