Incidental Mutation 'R5907:Scaf1'
ID 501677
Institutional Source Beutler Lab
Gene Symbol Scaf1
Ensembl Gene ENSMUSG00000038406
Gene Name SR-related CTD-associated factor 1
Synonyms
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 44652372-44665537 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 44663016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044111] [ENSMUST00000085383] [ENSMUST00000211735] [ENSMUST00000211680]
AlphaFold Q5U4C3
Predicted Effect probably benign
Transcript: ENSMUST00000044111
SMART Domains Protein: ENSMUSP00000042150
Gene: ENSMUSG00000038387

DomainStartEndE-ValueType
RAS 27 193 2.25e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085383
SMART Domains Protein: ENSMUSP00000082501
Gene: ENSMUSG00000038406

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 185 224 N/A INTRINSIC
coiled coil region 269 295 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
low complexity region 411 435 N/A INTRINSIC
low complexity region 488 511 N/A INTRINSIC
low complexity region 534 618 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
low complexity region 703 726 N/A INTRINSIC
low complexity region 730 739 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
Blast:IG_like 776 833 6e-6 BLAST
low complexity region 843 873 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
low complexity region 917 937 N/A INTRINSIC
coiled coil region 963 983 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1136 1146 N/A INTRINSIC
Blast:IG_like 1151 1194 2e-16 BLAST
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148227
AA Change: *128R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153243
AA Change: V62A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210056
Predicted Effect probably benign
Transcript: ENSMUST00000210397
Predicted Effect probably benign
Transcript: ENSMUST00000211735
Predicted Effect probably benign
Transcript: ENSMUST00000211680
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Scaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Scaf1 APN 7 44,662,934 (GRCm39) missense probably damaging 1.00
IGL02644:Scaf1 APN 7 44,655,357 (GRCm39) splice site probably benign
IGL02660:Scaf1 APN 7 44,661,542 (GRCm39) splice site probably benign
R0004:Scaf1 UTSW 7 44,657,094 (GRCm39) unclassified probably benign
R0326:Scaf1 UTSW 7 44,658,175 (GRCm39) missense probably damaging 1.00
R1395:Scaf1 UTSW 7 44,657,721 (GRCm39) missense probably damaging 0.99
R1799:Scaf1 UTSW 7 44,657,443 (GRCm39) missense probably damaging 0.97
R3037:Scaf1 UTSW 7 44,656,771 (GRCm39) unclassified probably benign
R4044:Scaf1 UTSW 7 44,655,798 (GRCm39) unclassified probably benign
R4808:Scaf1 UTSW 7 44,658,063 (GRCm39) missense probably damaging 0.99
R4871:Scaf1 UTSW 7 44,655,303 (GRCm39) unclassified probably benign
R4905:Scaf1 UTSW 7 44,662,129 (GRCm39) missense probably damaging 1.00
R5214:Scaf1 UTSW 7 44,652,662 (GRCm39) unclassified probably benign
R5602:Scaf1 UTSW 7 44,657,007 (GRCm39) unclassified probably benign
R5748:Scaf1 UTSW 7 44,662,230 (GRCm39) splice site probably null
R6193:Scaf1 UTSW 7 44,656,204 (GRCm39) unclassified probably benign
R6207:Scaf1 UTSW 7 44,657,047 (GRCm39) unclassified probably benign
R6948:Scaf1 UTSW 7 44,662,971 (GRCm39) nonsense probably null
R6969:Scaf1 UTSW 7 44,657,253 (GRCm39) unclassified probably benign
R7039:Scaf1 UTSW 7 44,657,850 (GRCm39) missense probably damaging 1.00
R7179:Scaf1 UTSW 7 44,657,167 (GRCm39) missense unknown
R7356:Scaf1 UTSW 7 44,657,208 (GRCm39) missense unknown
R7480:Scaf1 UTSW 7 44,657,073 (GRCm39) missense unknown
R7632:Scaf1 UTSW 7 44,656,503 (GRCm39) missense unknown
R7971:Scaf1 UTSW 7 44,652,965 (GRCm39) missense unknown
R8354:Scaf1 UTSW 7 44,657,251 (GRCm39) unclassified probably benign
R8770:Scaf1 UTSW 7 44,656,129 (GRCm39) missense unknown
R9414:Scaf1 UTSW 7 44,652,716 (GRCm39) missense unknown
R9551:Scaf1 UTSW 7 44,658,351 (GRCm39) missense probably damaging 1.00
R9552:Scaf1 UTSW 7 44,658,351 (GRCm39) missense probably damaging 1.00
R9749:Scaf1 UTSW 7 44,656,576 (GRCm39) missense unknown
X0020:Scaf1 UTSW 7 44,654,953 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTGTTTGGAAAGCACATTC -3'
(R):5'- AATGGCTCTAGTCCCTGCAG -3'

Sequencing Primer
(F):5'- AATTCTTCCTGAAGGCCTGG -3'
(R):5'- TCTAGTCCCTGCAGGTCAG -3'
Posted On 2017-12-01