Mutagenetix > Incidental Mutations

Incidental Mutation 'R5974:Cntnap5c'

501691

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5c

Ensembl Gene

ENSMUSG00000038048

Gene Name

contactin associated protein-like 5C

Synonyms

MMRRC Submission

044157-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57769570-58410355 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57876485 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 62 (M62K)

Ref Sequence

ENSEMBL: ENSMUSP00000075416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076038]

Predicted Effect

probably benign
Transcript: ENSMUST00000076038
AA Change: M62K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: M62K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	29	174	1.26e-10	SMART
LamG	201	338	1.57e-29	SMART
LamG	387	521	3e-26	SMART
EGF	549	583	1.88e-1	SMART
Blast:FBG	586	769	8e-83	BLAST
LamG	811	938	4.37e-28	SMART
EGF	959	995	6.55e-1	SMART
LamG	1036	1172	2.08e-11	SMART
transmembrane domain	1240	1262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc4	T	C	5: 52,845,400	L261P	probably damaging	Het
Aqp6	A	G	15: 99,601,436	Y10C	probably benign	Het
Ccnb1ip1	A	T	14: 50,792,205	N133K	probably benign	Het
Clip4	A	T	17: 71,831,247	H433L	probably damaging	Het
Col12a1	A	G	9: 79,682,127	S1049P	probably damaging	Het
Col15a1	C	T	4: 47,258,683	T358I	probably benign	Het
Coro7	A	T	16: 4,631,889	D645E	possibly damaging	Het
Ctnnal1	C	A	4: 56,817,067	W585L	probably damaging	Het
Ctnnd1	C	A	2: 84,620,915	E114*	probably null	Het
Daam2	T	A	17: 49,464,473	S882C	probably damaging	Het
Des	T	A	1: 75,362,984	S329T	probably benign	Het
Dido1	T	C	2: 180,671,497	D994G	probably benign	Het
Dock3	A	G	9: 106,994,062	V547A	probably damaging	Het
Ebf4	G	A	2: 130,365,564	A643T	probably damaging	Het
Ect2	C	A	3: 27,144,963	E194*	probably null	Het
Epb41l2	A	G	10: 25,441,815	I77V	possibly damaging	Het
Fat3	A	T	9: 16,006,528		probably null	Het
Fbn2	T	G	18: 58,048,920	D1803A	probably damaging	Het
Fbxo10	T	C	4: 45,040,631	E858G	probably benign	Het
Fbxo24	C	T	5: 137,619,650	R284Q	probably benign	Het
Fsip2	T	A	2: 82,963,313	I425N	possibly damaging	Het
Fut9	A	C	4: 25,620,090	Y241*	probably null	Het
Galr2	A	G	11: 116,283,026	S161G	possibly damaging	Het
Gcc2	T	A	10: 58,258,243	L14I	probably damaging	Het
Gm11127	A	T	17: 36,056,785	D220E	probably benign	Het
Hdac11	G	A	6: 91,173,214	V332I	probably benign	Het
Hdac7	T	C	15: 97,802,072		probably null	Het
Kif16b	C	T	2: 142,857,381	G93D	probably damaging	Het
Krtap11-1	C	A	16: 89,570,768	C121F	possibly damaging	Het
Lacc1	T	C	14: 77,035,077	Q93R	probably damaging	Het
Lama1	T	C	17: 67,773,727	F1250S	probably benign	Het
Lmbrd2	A	G	15: 9,172,115	E332G	probably benign	Het
Lrp2	C	A	2: 69,459,548	C3649F	probably damaging	Het
Map1a	T	C	2: 121,304,376	V1653A	probably benign	Het
Mrpl1	T	C	5: 96,231,794		probably null	Het
Myo1b	A	G	1: 51,778,373	S577P	probably damaging	Het
Nedd4	T	A	9: 72,743,638		probably null	Het
Negr1	T	A	3: 157,069,286	V213E	probably damaging	Het
Nlk	T	G	11: 78,590,966	Q223P	probably benign	Het
Ntn5	A	G	7: 45,691,424	H162R	probably damaging	Het
Nupl2	T	C	5: 24,167,402	S63P	probably damaging	Het
Obscn	C	A	11: 59,076,547	D477Y	probably damaging	Het
Olfr101	A	T	17: 37,300,338	I28N	possibly damaging	Het
Olfr1037	T	C	2: 86,084,881	S299G	probably benign	Het
Olfr1434	T	C	19: 12,283,836	S263P	probably damaging	Het
Pabpn1	A	G	14: 54,897,160	T280A	probably damaging	Het
Per3	A	T	4: 151,042,737	V109E	possibly damaging	Het
Pira2	A	C	7: 3,841,577	V485G	probably benign	Het
Pknox2	A	G	9: 36,936,322	L133P	probably damaging	Het
Pros1	A	C	16: 62,900,667	N195T	probably damaging	Het
Rffl	T	C	11: 82,806,151	K289E	probably damaging	Het
Ripk1	T	A	13: 34,030,101	Y475*	probably null	Het
Ryr2	A	G	13: 11,714,511		probably null	Het
Sgk1	T	A	10: 21,996,249	N241K	probably damaging	Het
Skint1	T	A	4: 112,019,319	S146T	probably benign	Het
Sox30	G	T	11: 45,981,073	D252Y	probably damaging	Het
Syngap1	A	G	17: 26,963,038	Y1002C	probably damaging	Het
Tiam2	A	G	17: 3,414,809	D271G	possibly damaging	Het
Ticam1	T	C	17: 56,271,178	T306A	probably benign	Het
Tmem252	A	G	19: 24,674,268	E67G	probably benign	Het
Tnxb	T	G	17: 34,685,707	F1149V	probably damaging	Het
Ubr4	A	G	4: 139,421,078		probably null	Het
Unc50	A	G	1: 37,437,209	D150G	probably benign	Het
Ywhag	A	C	5: 135,911,629	L37R	probably damaging	Het
Zfp296	T	C	7: 19,577,937	L123P	probably benign	Het
Zfp418	G	T	7: 7,182,200	Q387H	possibly damaging	Het
Zfp882	T	C	8: 71,913,155	F53L	probably damaging	Het

Other mutations in Cntnap5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Cntnap5c	APN	17	58162277	missense	probably benign	0.00
IGL00543:Cntnap5c	APN	17	58294350	missense	probably benign
IGL00679:Cntnap5c	APN	17	58055678	missense	probably damaging	0.98
IGL00942:Cntnap5c	APN	17	57769598	missense	probably benign	0.03
IGL01352:Cntnap5c	APN	17	58293901	missense	probably benign	0.00
IGL01822:Cntnap5c	APN	17	58055705	missense	probably damaging	0.99
IGL01864:Cntnap5c	APN	17	58410242	missense	probably benign
IGL01922:Cntnap5c	APN	17	58330119	missense	possibly damaging	0.95
IGL02111:Cntnap5c	APN	17	58102108	missense	probably damaging	1.00
IGL02112:Cntnap5c	APN	17	58313858	missense	probably benign	0.00
IGL02259:Cntnap5c	APN	17	58034862	missense	probably damaging	0.98
IGL02270:Cntnap5c	APN	17	58034853	missense	probably benign	0.08
IGL02312:Cntnap5c	APN	17	58138699	missense	probably benign	0.09
IGL02456:Cntnap5c	APN	17	58407744	splice site	probably benign
IGL02755:Cntnap5c	APN	17	58364194	missense	probably benign	0.02
IGL02955:Cntnap5c	APN	17	57892102	splice site	probably benign
IGL03001:Cntnap5c	APN	17	58055639	missense	probably damaging	1.00
IGL03012:Cntnap5c	APN	17	58359234	missense	probably benign	0.01
IGL03243:Cntnap5c	APN	17	58102176	missense	probably benign	0.01
IGL03375:Cntnap5c	APN	17	58162205	missense	possibly damaging	0.94
IGL02802:Cntnap5c	UTSW	17	58305684	missense	probably benign	0.04
LCD18:Cntnap5c	UTSW	17	58162160	intron	probably benign
R0003:Cntnap5c	UTSW	17	58199017	missense	probably benign
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0179:Cntnap5c	UTSW	17	57769625	missense	probably benign	0.19
R0244:Cntnap5c	UTSW	17	58102168	missense	probably damaging	1.00
R0445:Cntnap5c	UTSW	17	58104743	missense	probably benign	0.01
R0626:Cntnap5c	UTSW	17	58042427	missense	probably benign	0.29
R0675:Cntnap5c	UTSW	17	58034995	missense	probably damaging	1.00
R0681:Cntnap5c	UTSW	17	58305555	missense	possibly damaging	0.91
R0699:Cntnap5c	UTSW	17	58042498	missense	probably damaging	1.00
R0927:Cntnap5c	UTSW	17	58042558	missense	possibly damaging	0.78
R1081:Cntnap5c	UTSW	17	58305525	missense	possibly damaging	0.90
R1132:Cntnap5c	UTSW	17	58294356	missense	probably damaging	1.00
R1175:Cntnap5c	UTSW	17	58364246	missense	possibly damaging	0.51
R1640:Cntnap5c	UTSW	17	58395294	missense	probably benign	0.01
R1664:Cntnap5c	UTSW	17	58293990	missense	probably benign	0.00
R1758:Cntnap5c	UTSW	17	58042550	missense	probably damaging	1.00
R1785:Cntnap5c	UTSW	17	58162291	missense	probably benign	0.00
R1789:Cntnap5c	UTSW	17	58013921	missense	probably damaging	1.00
R1968:Cntnap5c	UTSW	17	58359296	missense	probably damaging	1.00
R2041:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R2041:Cntnap5c	UTSW	17	58198989	missense	probably benign	0.02
R2073:Cntnap5c	UTSW	17	58305552	missense	possibly damaging	0.58
R2093:Cntnap5c	UTSW	17	58199000	missense	probably benign	0.00
R2134:Cntnap5c	UTSW	17	58407722	missense	probably damaging	1.00
R2153:Cntnap5c	UTSW	17	58055671	missense	possibly damaging	0.90
R2176:Cntnap5c	UTSW	17	58013946	missense	probably benign	0.04
R2256:Cntnap5c	UTSW	17	58330315	missense	probably benign	0.00
R2847:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2848:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2850:Cntnap5c	UTSW	17	58410348	utr 3 prime	probably benign
R3008:Cntnap5c	UTSW	17	58359209	missense	probably damaging	1.00
R3714:Cntnap5c	UTSW	17	57892067	nonsense	probably null
R3720:Cntnap5c	UTSW	17	58330202	missense	probably benign
R3755:Cntnap5c	UTSW	17	58104599	missense	possibly damaging	0.82
R4001:Cntnap5c	UTSW	17	58407740	critical splice donor site	probably null
R4619:Cntnap5c	UTSW	17	58410268	missense	probably benign
R5146:Cntnap5c	UTSW	17	58013847	missense	probably damaging	0.96
R5309:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5312:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5722:Cntnap5c	UTSW	17	58313857	missense	probably benign	0.01
R6017:Cntnap5c	UTSW	17	58104698	missense	probably benign	0.41
R6059:Cntnap5c	UTSW	17	58313712	missense	probably damaging	0.99
R6152:Cntnap5c	UTSW	17	58286886	missense	possibly damaging	0.65
R6182:Cntnap5c	UTSW	17	57876395	missense	probably benign	0.00
R6298:Cntnap5c	UTSW	17	58104752	missense	probably damaging	1.00
R6301:Cntnap5c	UTSW	17	57892037	missense	probably benign	0.01
R6514:Cntnap5c	UTSW	17	58330170	missense	probably damaging	0.96
R6583:Cntnap5c	UTSW	17	58330277	missense	probably damaging	1.00
R6688:Cntnap5c	UTSW	17	58293904	missense	possibly damaging	0.71
R6781:Cntnap5c	UTSW	17	58138653	nonsense	probably null
R6866:Cntnap5c	UTSW	17	58092294	missense	probably benign
R6906:Cntnap5c	UTSW	17	58395307	missense	probably benign	0.18
R6911:Cntnap5c	UTSW	17	57892014	missense	probably damaging	1.00
R6919:Cntnap5c	UTSW	17	58293953	missense	probably benign	0.02
R6923:Cntnap5c	UTSW	17	58092350	missense	possibly damaging	0.96
R6925:Cntnap5c	UTSW	17	58395266	missense	probably benign	0.39
R6982:Cntnap5c	UTSW	17	58092252	missense	possibly damaging	0.77
R7144:Cntnap5c	UTSW	17	58286888	missense	probably benign
R7422:Cntnap5c	UTSW	17	58410231	nonsense	probably null
R7797:Cntnap5c	UTSW	17	58359275	missense	probably benign	0.11
R7830:Cntnap5c	UTSW	17	58162250	missense	probably damaging	1.00
RF010:Cntnap5c	UTSW	17	58286795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTAGCTTCTCCAGAGCAAATG -3'
(R):5'- ATGTTGCCTATTACATGCTGGG -3'

Sequencing Primer
(F):5'- TCTCCAGAGCAAATGGTTAATAAAC -3'
(R):5'- GTTGCCTATTACATGCTGGGAAGAAC -3'

Posted On

2017-12-01