Incidental Mutation 'R5975:Zcrb1'
ID 501693
Institutional Source Beutler Lab
Gene Symbol Zcrb1
Ensembl Gene ENSMUSG00000022635
Gene Name zinc finger CCHC-type and RNA binding motif 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 93386097-93398334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93395615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 29 (I29L)
Ref Sequence ENSEMBL: ENSMUSP00000125442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000076070] [ENSMUST00000109256] [ENSMUST00000161409] [ENSMUST00000162160] [ENSMUST00000165935] [ENSMUST00000229071] [ENSMUST00000230385]
AlphaFold Q9CZ96
Predicted Effect probably benign
Transcript: ENSMUST00000049122
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068457
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076070
AA Change: I29L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075441
Gene: ENSMUSG00000022635
AA Change: I29L

DomainStartEndE-ValueType
RRM 11 84 3.3e-24 SMART
ZnF_C2HC 106 122 3.83e-3 SMART
low complexity region 125 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109256
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160407
Predicted Effect probably benign
Transcript: ENSMUST00000161409
AA Change: I29L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125442
Gene: ENSMUSG00000022635
AA Change: I29L

DomainStartEndE-ValueType
Pfam:RRM_1 12 45 8.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161955
Predicted Effect probably benign
Transcript: ENSMUST00000162160
AA Change: I29L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124549
Gene: ENSMUSG00000022635
AA Change: I29L

DomainStartEndE-ValueType
RRM 11 84 3.3e-24 SMART
ZnF_C2HC 106 122 3.83e-3 SMART
low complexity region 125 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165935
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229071
Predicted Effect probably benign
Transcript: ENSMUST00000230385
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing is catalyzed by the spliceosome. U12-type spliceosome binds U12-type pre-mRNAs and recognizes the 5' splice site and branch-point sequence. U11 and U12 snRNPs are components of U12-type spliceosome and function as a molecular bridge connecting both ends of the intron. The protein encoded by this gene contains a RNA recognition motif. It was identified as one of the protein components of U11/U12 snRNPs. This protein and many other U11/U12 snRNP proteins are highly conserved in organisms known to contain U12-type introns. These proteins have been shown to be essential for cell viability, suggesting the key roles in U12-type splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Zcrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0894:Zcrb1 UTSW 15 93397157 unclassified probably benign
R0926:Zcrb1 UTSW 15 93391528 missense probably damaging 1.00
R2135:Zcrb1 UTSW 15 93397186 missense probably damaging 1.00
R5174:Zcrb1 UTSW 15 93387575 critical splice donor site probably null
R6058:Zcrb1 UTSW 15 93387582 missense probably benign
R7807:Zcrb1 UTSW 15 93391121 missense probably damaging 1.00
R8269:Zcrb1 UTSW 15 93397175 missense probably benign 0.00
R8682:Zcrb1 UTSW 15 93386237 missense probably benign 0.00
R9027:Zcrb1 UTSW 15 93387575 critical splice donor site probably null
U24488:Zcrb1 UTSW 15 93387634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAGTATGTCTCAGGCTCTG -3'
(R):5'- TAGACATGCTGAGTGGTCCC -3'

Sequencing Primer
(F):5'- CTGTTTCTCAGCACTGTAAAAGC -3'
(R):5'- AGGAACTGAAGCTTGTAACTCC -3'
Posted On 2017-12-01