Incidental Mutation 'R5913:Hax1'
ID501695
Institutional Source Beutler Lab
Gene Symbol Hax1
Ensembl Gene ENSMUSG00000027944
Gene NameHCLS1 associated X-1
SynonymsHAX-1, Hs1bp1, HS1-associated protein X-1, Silg111, mHAX-1s
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5913 (G1)
Quality Score217
Status Validated
Chromosome3
Chromosomal Location89995446-89998780 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCATCATCATCATCATC to GTCATCATCATCATCATCATC at 89997940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000079724] [ENSMUST00000196843] [ENSMUST00000197432] [ENSMUST00000197725] [ENSMUST00000197767] [ENSMUST00000197786] [ENSMUST00000198322] [ENSMUST00000198782] [ENSMUST00000199050] [ENSMUST00000199163] [ENSMUST00000199740]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079724
SMART Domains Protein: ENSMUSP00000078661
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197432
SMART Domains Protein: ENSMUSP00000143136
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197481
Predicted Effect probably benign
Transcript: ENSMUST00000197725
SMART Domains Protein: ENSMUSP00000142741
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 119 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197767
SMART Domains Protein: ENSMUSP00000142445
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197786
SMART Domains Protein: ENSMUSP00000142627
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198782
SMART Domains Protein: ENSMUSP00000143155
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199014
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199469
Predicted Effect probably benign
Transcript: ENSMUST00000199740
SMART Domains Protein: ENSMUSP00000143557
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
SCOP:d1qbkb_ 4 18 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletion of this gene fail to survive beyond 14 weeks of age. Apoptosis of neurons in the striatum and cerebellum occurs as does loss of lymphocytes and neutrophiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Hax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Hax1 APN 3 89997447 missense possibly damaging 0.90
R0848:Hax1 UTSW 3 89995633 missense probably damaging 1.00
R1386:Hax1 UTSW 3 89995849 missense probably damaging 1.00
R1479:Hax1 UTSW 3 89995857 missense probably damaging 1.00
R4241:Hax1 UTSW 3 89995690 missense probably damaging 0.96
R4604:Hax1 UTSW 3 89997460 missense probably damaging 0.99
R5354:Hax1 UTSW 3 89997955 missense probably damaging 0.98
R5704:Hax1 UTSW 3 89996096 missense probably damaging 1.00
R5866:Hax1 UTSW 3 89995728 unclassified probably benign
R5905:Hax1 UTSW 3 89997940 small insertion probably benign
R5914:Hax1 UTSW 3 89997940 small insertion probably benign
R5973:Hax1 UTSW 3 89997940 small insertion probably benign
R5978:Hax1 UTSW 3 89997940 small insertion probably benign
R6026:Hax1 UTSW 3 89997940 small insertion probably benign
R6028:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6054:Hax1 UTSW 3 89997940 small insertion probably benign
R6857:Hax1 UTSW 3 89997452 missense probably damaging 0.99
R7308:Hax1 UTSW 3 89998566 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATTCACACACCAGGAGAGTGG -3'
(R):5'- GAAACCAGATCTCCTGTGTTTTCAG -3'

Sequencing Primer
(F):5'- AAGGCAAGGTCCAGGCC -3'
(R):5'- GTGTTTTCAGCTGCCCAGAC -3'
Posted On2017-12-01