Incidental Mutation 'R5914:Hax1'
ID501703
Institutional Source Beutler Lab
Gene Symbol Hax1
Ensembl Gene ENSMUSG00000027944
Gene NameHCLS1 associated X-1
SynonymsHAX-1, Hs1bp1, HS1-associated protein X-1, Silg111, mHAX-1s
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R5914 (G1)
Quality Score207
Status Validated
Chromosome3
Chromosomal Location89995446-89998780 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCATCATCATCATCATC to GTCATCATCATCATCATCATC at 89997940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000079724] [ENSMUST00000196843] [ENSMUST00000197432] [ENSMUST00000197725] [ENSMUST00000197767] [ENSMUST00000197786] [ENSMUST00000198322] [ENSMUST00000198782] [ENSMUST00000199050] [ENSMUST00000199163] [ENSMUST00000199740]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079724
SMART Domains Protein: ENSMUSP00000078661
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197432
SMART Domains Protein: ENSMUSP00000143136
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197481
Predicted Effect probably benign
Transcript: ENSMUST00000197725
SMART Domains Protein: ENSMUSP00000142741
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 119 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197767
SMART Domains Protein: ENSMUSP00000142445
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197786
SMART Domains Protein: ENSMUSP00000142627
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198782
SMART Domains Protein: ENSMUSP00000143155
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199014
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199469
Predicted Effect probably benign
Transcript: ENSMUST00000199740
SMART Domains Protein: ENSMUSP00000143557
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
SCOP:d1qbkb_ 4 18 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletion of this gene fail to survive beyond 14 weeks of age. Apoptosis of neurons in the striatum and cerebellum occurs as does loss of lymphocytes and neutrophiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Hax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Hax1 APN 3 89997447 missense possibly damaging 0.90
R0848:Hax1 UTSW 3 89995633 missense probably damaging 1.00
R1386:Hax1 UTSW 3 89995849 missense probably damaging 1.00
R1479:Hax1 UTSW 3 89995857 missense probably damaging 1.00
R4241:Hax1 UTSW 3 89995690 missense probably damaging 0.96
R4604:Hax1 UTSW 3 89997460 missense probably damaging 0.99
R5354:Hax1 UTSW 3 89997955 missense probably damaging 0.98
R5704:Hax1 UTSW 3 89996096 missense probably damaging 1.00
R5866:Hax1 UTSW 3 89995728 unclassified probably benign
R5905:Hax1 UTSW 3 89997940 small insertion probably benign
R5913:Hax1 UTSW 3 89997940 small insertion probably benign
R5973:Hax1 UTSW 3 89997940 small insertion probably benign
R5978:Hax1 UTSW 3 89997940 small insertion probably benign
R6026:Hax1 UTSW 3 89997940 small insertion probably benign
R6028:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6054:Hax1 UTSW 3 89997940 small insertion probably benign
R6857:Hax1 UTSW 3 89997452 missense probably damaging 0.99
R7308:Hax1 UTSW 3 89998566 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AATTCACACACCAGGAGAGTG -3'
(R):5'- AACCAGATCTCCTGTGTTTTCAG -3'

Sequencing Primer
(F):5'- AAGGCAAGGTCCAGGCC -3'
(R):5'- GTGTTTTCAGCTGCCCAGAC -3'
Posted On2017-12-01