Incidental Mutation 'R5915:Atp8b5'
ID 501707
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene Name ATPase, class I, type 8B, member 5
Synonyms 4930417M19Rik, FetA
MMRRC Submission 044112-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5915 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43267159-43373833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43370577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 951 (D951G)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
AlphaFold A3FIN4
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably damaging
Transcript: ENSMUST00000107942
AA Change: D951G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: D951G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,644,122 (GRCm39) V940E probably damaging Het
Adgrg7 A T 16: 56,550,748 (GRCm39) probably null Het
Alox12e T C 11: 70,209,050 (GRCm39) I399V possibly damaging Het
Apoa5 C A 9: 46,180,607 (GRCm39) Q42K probably damaging Het
Arfgap1 A G 2: 180,620,215 (GRCm39) Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 (GRCm39) probably null Het
Arl16 G A 11: 120,357,431 (GRCm39) probably benign Het
Babam2 T A 5: 31,942,955 (GRCm39) L80Q probably damaging Het
Celsr1 C T 15: 85,822,176 (GRCm39) V1714I probably benign Het
Celsr1 C T 15: 85,914,550 (GRCm39) R1141H probably damaging Het
Cep295 A G 9: 15,252,775 (GRCm39) L351P probably damaging Het
Dlc1 T A 8: 37,405,829 (GRCm39) probably benign Het
Dpy30 G T 17: 74,622,906 (GRCm39) D25E probably benign Het
Drosha T C 15: 12,935,152 (GRCm39) W998R probably damaging Het
Fibp A G 19: 5,513,644 (GRCm39) D220G possibly damaging Het
Grm3 C T 5: 9,561,927 (GRCm39) C641Y probably damaging Het
Gulo A T 14: 66,245,570 (GRCm39) V8D probably benign Het
Ifrd1 A T 12: 40,263,095 (GRCm39) C164S possibly damaging Het
Jam2 G A 16: 84,606,295 (GRCm39) S103N probably benign Het
Krtap17-1 T C 11: 99,884,444 (GRCm39) T108A unknown Het
Man2a2 A G 7: 80,010,669 (GRCm39) F774S probably benign Het
Map1b G A 13: 99,566,839 (GRCm39) R1961W unknown Het
Mib2 A G 4: 155,740,508 (GRCm39) probably benign Het
Mr1 A T 1: 155,012,534 (GRCm39) F127I probably damaging Het
Mrgprb2 A G 7: 48,202,554 (GRCm39) I57T probably benign Het
Ncan G T 8: 70,550,731 (GRCm39) Y1154* probably null Het
Nfx1 T A 4: 40,977,285 (GRCm39) S320T probably benign Het
Nlrp4f A G 13: 65,335,369 (GRCm39) L740P probably damaging Het
Nprl2 T C 9: 107,422,277 (GRCm39) probably benign Het
Opn1sw A G 6: 29,379,754 (GRCm39) probably null Het
Or5bw2 A T 7: 6,573,172 (GRCm39) I61F probably benign Het
Palld A G 8: 61,986,386 (GRCm39) probably null Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Rnf145 T C 11: 44,433,549 (GRCm39) probably null Het
Sbf2 A T 7: 109,977,303 (GRCm39) C610* probably null Het
Sec24a C T 11: 51,646,964 (GRCm39) A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 (GRCm39) probably benign Het
Sox8 A C 17: 25,786,443 (GRCm39) L420R probably damaging Het
Sry C G Y: 2,662,612 (GRCm39) Q349H unknown Het
Sspo A G 6: 48,441,530 (GRCm39) D1889G probably benign Het
Sspo A T 6: 48,468,418 (GRCm39) H4382L possibly damaging Het
Tmem65 T C 15: 58,662,037 (GRCm39) I141V probably damaging Het
Tpr A T 1: 150,301,400 (GRCm39) T1329S probably benign Het
Trim17 C T 11: 58,859,388 (GRCm39) R201W probably damaging Het
Trim3 A G 7: 105,267,182 (GRCm39) L399P possibly damaging Het
Trim7 A G 11: 48,736,477 (GRCm39) D277G possibly damaging Het
Vstm2b A G 7: 40,552,107 (GRCm39) N153S possibly damaging Het
Wnk2 G T 13: 49,231,561 (GRCm39) Q786K probably damaging Het
Wnk4 A G 11: 101,154,720 (GRCm39) *286W probably null Het
Xpot A T 10: 121,450,998 (GRCm39) L134Q probably damaging Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zc3h7a G A 16: 10,982,466 (GRCm39) Q20* probably null Het
Zfp599 C T 9: 22,161,130 (GRCm39) C345Y probably damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43,355,567 (GRCm39) missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43,311,938 (GRCm39) missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43,302,628 (GRCm39) missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43,368,010 (GRCm39) missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43,291,693 (GRCm39) missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43,366,638 (GRCm39) missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43,320,590 (GRCm39) critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43,364,167 (GRCm39) missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43,334,205 (GRCm39) missense probably benign
IGL02456:Atp8b5 APN 4 43,365,578 (GRCm39) missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43,369,634 (GRCm39) missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43,366,770 (GRCm39) missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43,305,774 (GRCm39) missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43,369,715 (GRCm39) critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43,366,057 (GRCm39) missense probably benign
R0256:Atp8b5 UTSW 4 43,302,576 (GRCm39) intron probably benign
R0379:Atp8b5 UTSW 4 43,361,898 (GRCm39) missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43,291,672 (GRCm39) missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43,305,719 (GRCm39) intron probably benign
R1442:Atp8b5 UTSW 4 43,334,313 (GRCm39) missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43,302,590 (GRCm39) missense probably benign
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43,291,733 (GRCm39) critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43,344,430 (GRCm39) missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43,355,673 (GRCm39) missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43,372,903 (GRCm39) missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43,372,906 (GRCm39) missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43,361,804 (GRCm39) missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43,357,063 (GRCm39) missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43,369,688 (GRCm39) missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43,370,726 (GRCm39) missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43,361,953 (GRCm39) splice site probably benign
R3023:Atp8b5 UTSW 4 43,311,957 (GRCm39) missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43,372,697 (GRCm39) missense probably benign
R3690:Atp8b5 UTSW 4 43,368,055 (GRCm39) missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43,365,591 (GRCm39) missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43,357,016 (GRCm39) missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43,320,629 (GRCm39) missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43,365,955 (GRCm39) missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43,372,710 (GRCm39) missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43,308,504 (GRCm39) makesense probably null
R4784:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43,356,980 (GRCm39) missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43,344,449 (GRCm39) missense probably benign
R5422:Atp8b5 UTSW 4 43,366,644 (GRCm39) missense probably benign 0.10
R6228:Atp8b5 UTSW 4 43,304,674 (GRCm39) missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43,371,003 (GRCm39) missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43,334,249 (GRCm39) missense probably benign
R6931:Atp8b5 UTSW 4 43,364,108 (GRCm39) critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43,355,618 (GRCm39) missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43,361,835 (GRCm39) missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43,357,018 (GRCm39) missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43,342,640 (GRCm39) missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43,366,021 (GRCm39) missense probably benign
R7465:Atp8b5 UTSW 4 43,271,269 (GRCm39) missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43,366,609 (GRCm39) missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43,370,823 (GRCm39) critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43,366,735 (GRCm39) missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43,342,471 (GRCm39) missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43,356,982 (GRCm39) nonsense probably null
R8218:Atp8b5 UTSW 4 43,372,728 (GRCm39) critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43,366,072 (GRCm39) missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43,291,714 (GRCm39) missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43,342,439 (GRCm39) missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43,304,687 (GRCm39) missense
R8942:Atp8b5 UTSW 4 43,353,658 (GRCm39) missense probably damaging 1.00
R9153:Atp8b5 UTSW 4 43,308,493 (GRCm39) utr 3 prime probably benign
R9154:Atp8b5 UTSW 4 43,372,630 (GRCm39) missense probably benign 0.19
R9211:Atp8b5 UTSW 4 43,367,960 (GRCm39) missense probably damaging 0.97
R9361:Atp8b5 UTSW 4 43,369,658 (GRCm39) missense possibly damaging 0.80
R9786:Atp8b5 UTSW 4 43,305,798 (GRCm39) missense probably damaging 0.97
X0025:Atp8b5 UTSW 4 43,366,774 (GRCm39) missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43,361,903 (GRCm39) missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43,370,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATCCTCACTGCCTCCAAGTG -3'
(R):5'- GGAGATGTCCTTCCCATCATTGC -3'

Sequencing Primer
(F):5'- GAGACCATCTCAAGGCTTTCTAG -3'
(R):5'- CATCATTGCGCTCTGAGTTGAAGAC -3'
Posted On 2017-12-01