Incidental Mutation 'R5924:Pax8'
ID 501723
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Name paired box 8
Synonyms Pax-8
MMRRC Submission 044119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5924 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 24420560-24475599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24421622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 434 (S434P)
Ref Sequence ENSEMBL: ENSMUSP00000028355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000149294] [ENSMUST00000153601]
AlphaFold Q00288
Predicted Effect probably damaging
Transcript: ENSMUST00000028355
AA Change: S434P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: S434P

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect silent
Transcript: ENSMUST00000149294
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149860
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Cep78 A T 19: 15,961,066 L506Q probably damaging Het
Col6a1 A G 10: 76,718,371 probably null Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Epha5 A T 5: 84,233,674 Y439* probably null Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Lpin1 A T 12: 16,544,657 S795T possibly damaging Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Mtmr14 A G 6: 113,253,789 Y118C probably damaging Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24421391 unclassified probably benign
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2289:Pax8 UTSW 2 24440740 missense probably benign 0.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
R7658:Pax8 UTSW 2 24436511 missense probably benign 0.00
R7660:Pax8 UTSW 2 24436561 missense probably benign
R7690:Pax8 UTSW 2 24441670 missense probably benign 0.37
R7775:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24429597 missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24421555 missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24422971 missense probably damaging 0.99
R8520:Pax8 UTSW 2 24443022 missense probably damaging 1.00
R9651:Pax8 UTSW 2 24441161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGGCAATGCTGGAATTG -3'
(R):5'- TTTCTGGTTAGAGACTCAAAGGTGAG -3'

Sequencing Primer
(F):5'- CAATGCTGGAATTGTGGTTATTTTTC -3'
(R):5'- CTCAAAGGTGAGGCCAAAGAAAG -3'
Posted On 2017-12-01